1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
8

Which term best describes the makeup of a biome?

Biology
1 answer:
Alexxx [7]3 years ago
3 0
I would chose the 4th one because biome is made up of a bunch of little biospheres
You might be interested in
What is the impact of a nonsence mutation?
aliya0001 [1]

Answer:b

Explanation:I believe it’s b I looked it up on google

6 0
3 years ago
What evidence do paleobotanists look for that indicates the movement of plants from water to land?
attashe74 [19]

The evidence that paleobotanists look for that indicates the movement of plants from water to land is the possession of waxy cuticle to decrease evaporation from leaves.

<h3>What are some adaptations of plants on land compared to water?</h3>

Plants possess various adaptive features which enables them to survive on land or in water.

Plants that are found in water are known as aquatic plants. They possess features which enable them to get rid of excess water as well as to stay afloat on water. For example, their leaves are waxy to enable them remain afloat.

Plants found on land are terrestrial plants and possess features that enable them survive on land. They possess features which prevent excessive water loss such as waxy cuticle.

Therefore, the evidence that paleobotanists look for that indicates the movement of plants from water to land is the possession of waxy cuticle to decrease evaporation from leaves.

In conclusion, plants show adaptations as they moved from water to land.

Learn more about adaptations in plants at: brainly.com/question/13052054

#SPJ4

7 0
2 years ago
What information can not be obtained from the sequence of a gene? view available hint(s) what information can not be obtained fr
olganol [36]

The right answer is A.

The methylation profile of DNA is not obtained when DNA sequencing is performed.

Methylation is a process that can occur in DNA especially at the cytosine level. And this has a very important role in gene expression as it is part of the epigenetic expression.

Gene methylation can induce or repress gene expression depending on the localization of methylated bases.

5 0
3 years ago
Read 2 more answers
Someone please help, these questions are hard
Allushta [10]

Answer:

B: Polyermase Chain Reaction

Explanation:

PCR is when we take a segment of DNA and multiply it! We can see that the number of DNA segments are increasing therefore it is PCR. Hope this helps!

8 0
3 years ago
List the ten major biomes in the world
jolli1 [7]

1 tropical rain forest

2 tropical dry forest

3 desert

thats all i know :)
6 0
3 years ago
Read 2 more answers
Other questions:
  • 1. 1 <br> 2. 2 <br> 3. 3<br> 4. 4<br> 5. 5
    8·1 answer
  • Which is an example of potential energy
    10·2 answers
  • What is the relationship between uv radiation and skin color
    5·1 answer
  • The brain's outermost cellular layer is called the:
    12·2 answers
  • I need to put these in order
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Federal aid for the U.S. Fish and Wildlife Service stems from the ____
    10·1 answer
  • A pioneer species is...
    7·1 answer
  • I don’t feel like doing the science so can somebody help I’ll mark brainlyest
    13·1 answer
  • HELP HELP HELP HELP ANSWER THIS IN A SENTENCE
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!