1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
11

Which biome or ecosystem has a long dry season that makes growth or trees difficult?

Biology
1 answer:
Kobotan [32]3 years ago
4 0
The desert? Its completely dry so what other biome?
You might be interested in
Over half of the people in the United States rely on groundwater for drinking water.
djverab [1.8K]
Over half of the people in the United States rely on groundwater for drinking water. This is true.
6 0
3 years ago
Read 2 more answers
4. What is a function of the nucleus of an animal cell?
Nitella [24]

Answer:

A. It is the place where energy is produced.

It stores the genetic information, the DNA (chromosomes).

Explanation:

4 0
2 years ago
With ______________, a woman is given hormones that stimulate the ripening of several ova. These are removed surgically and plac
Anastaziya [24]

Answer: In vitro fertilization

Explanation:

In vitro fertilization (IVF) involves some procedures used to help with fertility. This series of procedures are usually complex and can help prevent genetic problems and assist with the conception of a child.

During IVF, mature eggs are collected from the female ovaries and sperms from the male and fertilized in the laboratory. The fertilized egg are then transfered back into the uterus for its growth and development.

The sperm and eggs could be from partners who have decided to carry out IVF or from donors. IVF is usually Carried out by high rating laboratory. One full cycle of IVF takes about three weeks. IVF are usually expensive and could take a longer time if splits into different aspects.

IVF is an effective reproductive technology.

5 0
3 years ago
Is cc heterozygous or homogeneous?
Alex73 [517]

Answer:

cc is homoozygous i think

Explanation:

5 0
3 years ago
Read 2 more answers
Check all answers that apply. Instructions for making proteins are stored in
Serjik [45]
Instructions for making proteins are stored in DNA
5 0
4 years ago
Read 2 more answers
Other questions:
  • Often called the power plant of the cell, this is the site where most of the energy from carbohydrate, protein, and fat is captu
    11·2 answers
  • List three recessive genetic disorders
    15·2 answers
  • which process is part of the carbon cycle? A) evaporation B) transpiration C) photosynthesis C) fixation
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What does a completely filled circle represent on a pedigree chart?
    7·1 answer
  • If cells dont grow, the animal wont be able to do what three things?​
    13·2 answers
  • Both the ER and Golgi have folds. what is the advantage of folds on an organelle? A. Increased surface area B. Increased volume
    5·1 answer
  • How does crossing over ensure that organisms living in isolated populations will have genetic variation?
    11·2 answers
  • During which phase of the cell cycle do the replicated chromosomes thicken and become visible
    9·2 answers
  • What process happens farther up the river to bring the sediments to the delta?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!