Why do human traits such as height and skin color have many different phenotypes?

1 answer:

5 0

In fact, there is an enormous variety of phenotypes for height. Some human traits show a large number of phenotypes because the traits are controlled by many genes. The genes act together as a group to produce a single trait … Skin color is another human trait that is controlled by many genes.

You might be interested in

What is the name of the system that transports products of photosynthesis?

julsineya [31]

Plants have two systems for the transportation of substances - using two different types of transport tissue. Xylem transports water and solutes from the roots to the leaves, while phloem transports food from the leaves to the rest of the plant.

4 0

3 years ago

A function of carbohydrates in the diet is to: enable chemical reactions. promote growth and repair of tissues. supply energy. m

astra-53 [7]

<h2>Supply Energy</h2>

Explanation:

Carbohydrates, or saccharides, comes under biomolecules. The four significant classes of biomolecules are nucleotides, lipids, proteins and carbohydartes. Among these carbohydrates is more abundant.

It is also called "carbs," carbohydrates have a few jobs in living life forms, including energy transportation. They are the structural parts of insects and plants.

Carbohydrates derivatives are engaged with blood clotting, the immune system, the reproduction, the development of disease.

3 0

3 years ago

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.