1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gregori [183]
3 years ago
11

(6-6÷3)^2-4×3÷2 can anyone help me

Biology
2 answers:
marusya05 [52]3 years ago
8 0
The answer to the question is 10
saw5 [17]3 years ago
5 0

Answer:

10

Explanation:

(6−

6

3

)2−

(4)(3)

2

=(6−2)2−

(4)(3)

2

=42−

(4)(3)

2

=16−

(4)(3)

2

=16−

12

2

=16−6

https://www.mathpapa.com/algebra-calculator.html

You might be interested in
How does the skeletal system of an embryo differ from that of an adult?
Cloud [144]
Almost the entire system of an embryo is made of cartilage, whereas that of an adult is mostly made of bones.
8 0
3 years ago
When in the cell cycle does independent assortment of chromosomes occur?
Troyanec [42]
Process of cellular respiration.

3 0
3 years ago
*15 points* Earth Science
rusak2 [61]
Just saying it says 8 points ya little baka
3 0
3 years ago
What is the function of the swim bladder?
marshall27 [118]

Answer:

The swim bladder is located in the body cavity and is derived from an outpocketing of the digestive tube. It contains gas (usually oxygen) and functions as a hydrostatic, or ballast, organ, enabling the fish to maintain its depth without floating upward or sinking.

Explanation:

6 0
3 years ago
Read 2 more answers
The process of osmosis is best illustrated by the movement of a. water into root hair cells b. oxygen intro red blood cells c. c
barxatty [35]

Answer:

a. water into root hair cells

Explanation:

Osmosis can be defined as a process which typically involves the movement of a solvent molecule such as water through a semi-permeable from a region of high concentration to a region of lower concentration.

Hence, the process of osmosis is best illustrated by the movement of water into root hair cells because they are used by the plants to absorb water from the soil.

3 0
3 years ago
Other questions:
  • Genetic mutations what mistakes can occur when dna is replicated worksheet answers
    13·2 answers
  • A gyrus is an elevated ridge of cerebral tissue inward folds of cerebral tissue are called
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which cell specimen is a prokaryote
    14·1 answer
  • What is the objects acceleration
    9·1 answer
  • An alternative to a controlled experiment would be a(n). a.. quantitative study. b.. correlation study. c.. field study. d.. a l
    9·1 answer
  • Please help!!
    15·1 answer
  • What might happen to a pebble plant in the heat of the Sun if it had a large, flat surface with a thin body, like a Pancake?
    15·1 answer
  • Name the type of mutation​
    7·1 answer
  • A model of the solar system shows the sun as a loaf of bread. What size is everything else in this model?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!