1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ruslelena [56]
2 years ago
9

Which tropic level of a food chain consists of secondary consumers?

Biology
1 answer:
Alex2 years ago
3 0
The first level of his without the first level there would be a second level in the first level is pray and stuff so how is Prague and eat their food for the secondary
You might be interested in
Give an example of 3 detrivores. On what do they feed?
saw5 [17]

Answer:

Sea cucumber,Vulture,  and worms

they feed on dead organisms

Explanation:

4 0
2 years ago
Read 2 more answers
Which of the following characteristics do most amphibians share?
insens350 [35]

Answer:

`B

Explanation:

4 0
3 years ago
Read 2 more answers
Which part of the heart takes blood from the veins and pumps it into a ventricle?.
Savatey [412]
Answer:
The right atrium takes blood from the veins and pumps it into a ventricle

Please mark as brainliest
8 0
1 year ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Is an average leaf size continuous or discontinuous variation?
never [62]

Answer:

d

Explanation:its d trust

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which problem is most directly caused by burning waste?
    10·2 answers
  • Tables display data in row ad colums true or false
    7·2 answers
  • During the light- dependent reaction of photosynthesis light energy is coverted into form of energy?
    12·1 answer
  • HIII GIVING BRAINLIEST what is a 2 animal that don't have legs
    10·2 answers
  • A nurse is caring for a patient who has been receiving a drug by the intramuscular route but will receive the drug orally after
    15·1 answer
  • Anisogamy (different-size gametes) is a phenomenon found in many sexually reproducing species. Which of the following assumption
    10·1 answer
  • Entrepreneurs and business-owners of high uncertainty avoidance cultures will be more willing to take risks and make changes. Tr
    8·1 answer
  • Why does DNA make a good molecule for storing information
    11·1 answer
  • Which stage is the dominant stage in gymnosperms?
    14·2 answers
  • Earth science
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!