Answer:
C) Primary, tertiary and quaternary levels of protein structure
Explanation:
Primary structure; Covalent bond is present in form of peptide bond in the primary structuture of proteins. The amino acids are held together in the polypeptide chain by peptide bond.
Tertiary structure; Disulfide bonds are present between cysteine amino acids, that keeps the parts of polypeptide chain strongly attached to one another.
Quaternary structure; The Quaternary structure of protein is held together by hydrophobic interaction and disulfide bonds.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
They have a light complexion, may have not wore sunscreen, or was in direct contact with the sun all day.
Answer:
Independent Variable: Give one group the drug and dont give the other group the drug
Dependent Variable:The data of if the drug improves the rats memory(if their memory is better, the same, or made worse)
The answer is B, they were not overlapping in range, so they evolved and became not identical.
