1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
7

Find 4 human-related threats to seagrasses. Describe them fully.

Biology
1 answer:
emmasim [6.3K]3 years ago
4 0
<span>The 4-human related threats to seagrasses are caused mostly by human development. The most common are: Excessive dredging, careless boating, chemical waste in the sewers, and garbage.<span>

a. Excessive dredging due to the accommodation of building houses or other facilities that need proper sewage disposal has caused the destruction of many seagrasses and mangrove communities in the United States. 

b. Careless boating by boaters in the area who are not familiar with the local waters destroy the seagrasses with their propellers. To further prevent destruction, they are encouraged by the local government to familiarize themselves with the area and prevent boating in shallow waters where seagrasses are found.

<span>c. Chemicals found in the sewage system that leak cause the growth of excessive algae and bacteria. When this happens, they cover the surface area of the water causing little to no sunlight to appear underwater and reach the seagrasses. When this happens, seagrasses lack the capacity to produce oxygen through photosynthesis. Not only does this affect seagrasses but also marine life, when algae and bacteria build up they suck the oxygen that is necessary for the survival of various marine animals. </span>

<span>d. Garbage that decompose in land or in water produce poisonous chemicals that are also a threat not only to seagrasses but also to other marine life. </span></span></span>
You might be interested in
Considering only the 2 genes A &amp; B, how many genetically distinct gametes can this individual produce, if genetic recombinat
Paraphin [41]

Answer: Ask your mom

Explanation: She was in school before you duh

3 0
3 years ago
2.4 Explain the safety measures that one should consider when participating in physical education activities. ​
Alex17521 [72]
One should consider: proper clothing and shoes-so not to get injured. Knowledge of equipment and activity—one should know how to use all equipment and know how to play the games/activity so not to hurt themselves or others. Proper hydration and nutrition before hand-so not to get dehydrated or dizzy or sick and safety og equipment and location-check for broken items and discard, check environment for hills, holes, sticks, traffic, etc.
5 0
2 years ago
Sickle cell anemia is produced by a genetic defect in the amino acid sequence of hemoglobin. Persons who are homozygous for this
JulijaS [17]

Answer:

The probability is 1/2

Explanation:

Heterozygous for sickle cell allele is AS

Homozygous allele is SS

AS SS

The offspring formed include

AS, AS, SS, SS

The probability of their children being carriers include

Number of AS/ Total number of offspring

= 2/4 =1/2 or 0.5

8 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Single-celled eukaryotes arose from prokaryotes. Later, which larger, more complex organisms did they evolve into?
sdas [7]
A l,ll,lll and lV would be the answer because a eukaryote is an organism with complex cells, or a single cell with a complex structures. In these cells the genetic material is organized into chromosomes in the cell nucleus. Animals, plants, algae and fungi are all eukaryotes. There are also eukaryotes amongst single-celled protists.
5 0
3 years ago
Other questions:
  • A theory of evolution that states that a species evolves in spurts of rapid change and then goes through periods of no change is
    6·1 answer
  • Mechanical energy is the energy of _____.
    13·1 answer
  • On spring break you travel to Malibu, California. While there, you visit the famous Malibu beach to observe the parade of body b
    6·1 answer
  • Why is pyruvic acid never the end product of fermentation
    13·1 answer
  • What is the name of the process where DNA is<br> duplicated to create two strands of DNA?
    10·1 answer
  • {{40 POINTS!!}} DUE SOON!
    8·1 answer
  • What is a possible reason people would choose to live near volcano even with the possibility of volcanic eruption?
    7·1 answer
  • Why does the ocean heat and cool more slowly than the atmosphere?
    7·1 answer
  • Which term refers to the ability of a substance to be hammered or rolled into sheets?
    7·2 answers
  • Which of the following is a BEHAVIORAL adaptation?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!