1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
11

How are a heterozygous and a homozygous individual different?

Biology
1 answer:
Sidana [21]3 years ago
7 0

Answer:

Option (a).

Explanation:

Homozygotes individuals has the same genotype whereas the genotype of the heterozygotes are different. The homozygotes may refer the true or pure organism.

The gametes obatined from the homozygotes caaries the same gene. The gametes of the heterozygotes carries the different version of the gene. The dominant trait will express themselves in the heterozygotic condition.

Thus, the correct answer is option (a).

You might be interested in
Which statement correctly compares the inheritance of blood type in humans and the inheritance of length of ears in corn plants?
Sergio [31]
I think its A  but it has been a while since i did this.
7 0
3 years ago
Read 2 more answers
Which organ systems work together to provide oxygen to cells throughout the body?
Hoochie [10]

respitory systym and circulatory system because you need your lungs to breathe and the blood and heart to pump the oxygen into the blood. :))

8 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
The fastest moving seismic wave
Andru [333]

Answer: the answer is A(Primary Waves)

Explanation:

p waves stand for primary waves. early seismologists called them that because the waves were the first to arrive at seismometers from some distant quake

Hope this helps plz give me an brainiest

4 0
2 years ago
Glucagon is secreted from ________ cells of the pancreas and stimulates ________.
Pepsi [2]

Answer: D) alpha: catabolism

Explanation:

Glycogen is the storage form of carbohydrates in animals. The major sites of storage are liver and muscle.

Glucagon is a polypeptide hormone, it is secreted by the alpha cells of the pancreas. Low blood glucose causes glucagon secretion. When blood glucose level falls, liver glycogen is broken and help to maintain blood glucose level.

Glucagon stimulates the enzyme glycogen phospholylase which breaks down glycogen into glucose units.

5 0
3 years ago
Other questions:
  • Why do volcanoes occur
    13·2 answers
  • Binary fission is the most common form of reproduction in _____.
    13·2 answers
  • A 21-year-old patient has a head injury resulting from trauma and is unconscious. there are no other injuries. during the assess
    5·1 answer
  • Leachate is a harmless solution that can be pumped out of a landfill.<br> True or False
    14·2 answers
  • Match the sphere with its correct statement.
    5·2 answers
  • Which of the following statements about water is NOT TRUE?
    10·2 answers
  • What is everyone's view on time travel? Easy points. :)
    15·2 answers
  • Select the correct answer.
    6·1 answer
  • The TSW (Tsunami Warning System) is located in the Pacific Ocean and 26 different
    12·1 answer
  • Compare and contrast mutualism, commensalism, and parasitism.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!