1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oee [108]
3 years ago
11

Reflex activity can be modified by the cerebral cortex. For example, you are baking a roast in the oven. As you are moving the r

oast from the oven to the counter, hot juices splash you. Reflex activity would cause you to drop the pan, but you hold on to it. Explain how the cerebral cortex overrides the reflex.
Biology
1 answer:
Zanzabum3 years ago
7 0

Answer:

There are different types of reflexes, and some of them can be controlled voluntarily due to cortical processing.

Explanation:

Even if there is an initial myotactic reflex of moving away from the heat, the cortical processing that is subject to learning makes you not let go of the pan. It should be noted that there are different types of reflexes, and not all postural reactions are automatic. The cerebral cortex influences voluntary postural adjustment movements. Such control is mainly performed by the brain stem, where ocurrs the modulation of motor neurons and spinal cord interneurons through the lateral descending (fine movements) and medial (posture and balance) downward pathways.

You might be interested in
If Pat's has type A blood & his mom has type O blood which of the following blood
zhenek [66]

Answer:

type ab its more in formative

7 0
3 years ago
what would happen to the planet if all oxygen breathing organisms became extinct and only plants remained on the earth
stealth61 [152]

Many plants depend on animals primarily insects for pollination and sexual reproduction. If the animals (insects that pollinate) most flowering plants would be unable to reproduce and would go extinct.

Both plants and animals undergo cellular respiration producing Carbon Dioxide. Animals produce only Carbon Dioxide while plants produce both Carbon Dioxide and Oxygen. If animals went extinct there would be less Carbon Dioxide to support photosynthesis and more complex plants would have a difficult time adapting to the reduced levels of Carbon Dioxide.

Plants that survived the extinction of animals would be much simpler than presently complex plants.

Perhaps some plants would become predators of other plants to absorb the nitrogen content of other plants because of the lack of animals to engage in the recycling of nitrogen content.

3 0
3 years ago
What is the primary function of the phloem in vascular plants?
Dafna1 [17]

Answer:

transport sugar(glucose)

Explanation:

4 0
3 years ago
Read 2 more answers
In a population of owl monkeys, allele T codes for tufted tails ( TT and Tt). The
deff fn [24]

Answer:

C) The frequency of allele T would decrease and the frequency of allele t would increase.

Explanation:

If the hunter is going after monkeys with tufted tails (TT), the tufted tail monkeys would die out from the new predator, letting the non-tufted tails (tt) increase in population.

4 0
3 years ago
Chromosomal mutations usually Occur during?​
brilliants [131]

Answer:

The fundamental structure of a chromosome is subject to mutation, which will most likely occur during crossing over at meiosis.

Explanation:

4 0
2 years ago
Other questions:
  • Use ribosome in a sentence
    13·2 answers
  • Which method of classification requires that each taxonomic group be monophyletic
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Does diffusion require proteins?
    12·1 answer
  • Energy is converted from glucose, in the presence of oxygen, into numerous ATP molecules during
    9·1 answer
  • If a mother is a carrier of the recessive gene (Xx) for hemophilia and
    9·1 answer
  • The arctic region is a treeless plain with frozen ground. true or false
    11·1 answer
  • Toxic substances are also classified by how people are exposed to them. By definition, people may be exposed intentionally, acci
    13·1 answer
  • 2.) Imagine that you and your friend are at the beach. You have your chairs and umbrella set up in the perfect spot near the wat
    13·1 answer
  • In a food chain, consumers gather energy by _______. a. consuming organisms at a lower trophic level b. consuming organisms at a
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!