1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
4 years ago
5

Three connective tissue surrounding muscle groups is

Biology
1 answer:
dybincka [34]4 years ago
5 0
Endomysium (connective tissue that surrounds each muscle fiber (cell))
You might be interested in
Which of the following words best describes the nature of scientific knowledge?
andrey2020 [161]
Evolving. because science is always finding new things everyday and is discovering how things become more things. that is basically evolution.
3 0
4 years ago
Conservation biologists provide strong arguments about why we should all care about preserving biodiversity. When considering th
serious [3.7K]

Answer: Increase in ambient global temperatures.

Recyling energy to be used again

Regulation of oxygen and carbon dioxide levels

An increase of erosion and siltation along waterways

Explanation:

6 0
4 years ago
Malarial parasite is ? kinds of parasite
yawa3891 [41]
Malarial parasites are caused by Plasmodium parasites, these parasites infect humans via the bite of infected Anopheles mosquitoes. Some of these mosquitos are Plasmodium vivax, P. falciparum, <span>P. ovale, and P. malariae</span>
7 0
3 years ago
Plz help, will give brainliest!! I can’t write poems if my life depended on it!!
Serjik [45]

Answer:

Why don't you just look it up on google they have really good poems and you can change the words around so it's not plagiarism

Explanation:

4 0
3 years ago
What statement listed below is true of the stars in the Milky Way Galaxy?
UkoKoshka [18]

Answer:

Most of the stars in our galaxy are made of hydrogen gas.

6 0
3 years ago
Other questions:
  • What do proteins carbohydrates and lipids have in common
    5·2 answers
  • Many clinicians diagnose disorders by using criteria listed in the
    10·1 answer
  • In the context of perception, _____ processing involves starting with a sense of what is happening and then applying that framew
    11·1 answer
  • Your classmate states that only precious minerals,such as diamonds,are valuable. Based on your lesson on the rock cycle, you
    10·1 answer
  • How are the phases of Venus different than the phase of our moon?
    13·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Mass extinctions have occurred five times in Earth's history. The Permian and Cretaceous extinctions removed a large percentage
    15·1 answer
  • List all of the recessive traits you noticed in the pictures.
    12·2 answers
  • An increase in the biodiversity of an ecosystem leads to an increase in its productivity.
    10·1 answer
  • Which of the following situations<br> demonstrates a chemical change?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!