1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
3 years ago
5

5-8 PLEASE HELP!!!!!!!!

Biology
1 answer:
bagirrra123 [75]3 years ago
8 0
5: true
6: Oxygen
7: H+
8: true
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
An experiment would have a low validity if it had _____.
ANEK [815]
The answer is a. no controls
4 0
3 years ago
Read 2 more answers
What do flagella and cilia have in common
Naddika [18.5K]
Flagella and cilia have the exact same structures and functions, and the names merely indicate how many are present on a given cell. When found singly or in a pair, these cell protrusions are called flagella<span>.</span>
6 0
3 years ago
Read 2 more answers
PLEASE HELP 11. A group of lizards living in a desert would be an example of what? (5 points)
Anna35 [415]
Answer : A

Explain: succession is progressive changes and food web isn’t this example.
7 0
3 years ago
Why is the entire cell said to be like factory
levacccp [35]

A cell can be thought of as a "factory," with different departments each performing specialized tasks.

5 0
3 years ago
Other questions:
  • Radiometric dating is used to tell the absolute age of materials by studying the decay rate of radioactive isotopes. The decay r
    7·2 answers
  • Why do scientist divide the earth into to layers
    12·1 answer
  • Explain 3 different ways seeds can be transported from location to another
    10·2 answers
  • What the answer to this question?
    7·1 answer
  • What function is performed by both goblet cells and lacrimal glands? A. digestion B. stress regulation C. protection D. growth r
    5·1 answer
  • What is the only body part that can float on water
    13·1 answer
  • _______ part of our brain generates signals for involuntary action.​
    12·2 answers
  • Which of the statements about the relationship between DNA technology and genetic diversity is accurate? a.DNA technology can re
    7·2 answers
  • Linguists know how people began to speak.<br><br> A. true <br> B. false
    13·2 answers
  • Why do scientists focus on an animal's cognitive abilities rather than its "intelligence" when studying animal behavior?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!