1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
3 years ago
14

After sorting several insects using a dichotomous key, Jamila has a group that has these two dragonflies in it. Has Jamila compl

eted the sorting process? Explain your answer.
Biology
2 answers:
maksim [4K]3 years ago
6 0

Answer:

Explanation:

No, the sorting process is not completed yet. The group that has two dragonflies in it should be sorted out independently and matched together to form a specie. The dichotomous key is used to identify items that belong to a particular specie.

BigorU [14]3 years ago
5 0

Answer:

Jamila has not completed the sorting process. At the end of the sorting process, each insect should stand alone at the end of a branch

Explanation:

You might be interested in
Why is the nucleus considered the command center of the cell?
tigry1 [53]

Answer:

A

Explanation:

4 0
3 years ago
Read 2 more answers
Which phrase best defines a galaxy?
oksian1 [2.3K]

Answer:

Tightly packed group of older stars large grouping of more than two stars loose, disorganized star cluster held together by gravity large collection of stars, gas, and dust held together by gravity

Explanation:

Google

5 0
2 years ago
Read 2 more answers
Lotions applied during winter season moisturize the skin very quickly. What could be the reason for this?
MrRissso [65]

The right answer is D.

The absorption of molecules at the level of the skin is carried out by passive diffusion for the molecules of low molecular weight (lower than 400 Da), the skin being covered with a lipoprotein film rich in water by its stratum corneum, rendering it little-permeable.

This absorption may be variable according to factors related to the skin such as stratum corneum's thickness, the state of hydration, the presence of cutaneous lesions or individual variations.

External factors may also modulate percutaneous absorption such as contact time, iontophoresis or the presence of specific adjuvants.

8 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Cold case detectives are investigating a homicide that took place 30 years ago. in reexamining the evidence, they find a tiny sp
vaieri [72.5K]
Polymerase chain reaction to amplify the DNA would be the technique used in the blood lab.
3 0
3 years ago
Other questions:
  • What is the limiting factor for the growth of trees in the tundra? question 1 options:
    5·1 answer
  • Environmental science help!
    12·1 answer
  • Which structures are found in eukaryotic cells?
    15·1 answer
  • When a person becomes an adult most cells continue to divide for what two reasons?
    15·1 answer
  • What would occur if the muscle tissue failed within a damaged blood vessel?
    9·2 answers
  • As. Why do biennial plants need two years to complete<br>their live Span ?<br>​
    12·2 answers
  • What are Mitosis Similarities to Meiosis?
    13·1 answer
  • The movement of waves in the middle of the ocean is normally
    7·1 answer
  • WILL GIVEEE BRAINLIESTTT !!
    13·1 answer
  • 4
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!