1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svp [43]
3 years ago
13

How is engery moved from one organism to another?

Biology
1 answer:
yarga [219]3 years ago
6 0

Answer:

Eating each other

Explanation:

When one organism(Billy) eats another organism(Bobby), the energy is transferred into that organism.

E.

Bobby dies

Billy eats Bobby

Bobby's energy goes to Billy

Billy now has more energy

Hope this helps!

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which term best describes the collection of technological systems made by engineers, technologists, and scientists that meet peo
DIA [1.3K]
I think it's 1 or 2 I hope this helps
4 0
3 years ago
Can someone help me answer this easy question ?
sweet-ann [11.9K]

See that river on the bottom? That water has been flowing in the canyon for a long time and has slowly been chipping away at the rocks to give what you see today.

B. erosion from the water

7 0
3 years ago
Read 2 more answers
Biome with a salt water environment.<br> A. Estuary <br> B.Marine ​
erastovalidia [21]

Answer:

a

Explanation:

6 0
3 years ago
Read 2 more answers
Can anyone tell me the correct answer please
Cloud [144]
The correct answer would in fact be C
7 0
3 years ago
Read 2 more answers
Other questions:
  • The decaying plat matter found in bogs results in the production of
    15·2 answers
  • Whats one possible disadvantage of spraying insecticide from an airplane
    11·2 answers
  • During which phase of meiosis does crossing over occur?
    5·2 answers
  • In your own words, describe the purpose and process of translation. The purpose of translation is… The process of translation is
    7·1 answer
  • A partial food web is shown below. Which of the following organisms has the greatest biomass? plz be right i will mark
    11·1 answer
  • A good hypothesis can be formed only after asking a scientific question.
    15·2 answers
  • Why am I am idiot? I want my friends to come to me to a school and I have tried to convince them so much and succeeded. Now, I f
    6·1 answer
  • Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an a
    6·1 answer
  • 3. What is it called when layers pile up and press
    11·1 answer
  • Can someone helppppppppppppppppppppppp
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!