1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
1 year ago
12

2. Imagine that you are in a building and the fire alarm goes off. All of the doors around you lock shut, and you smell smoke.

Biology
1 answer:
andrew-mc [135]1 year ago
4 0

The main problem that your central nervous system will try to solve is how to get out of this place.

<h3>B. What is the somatic nervous system probably doing?</h3>

It is releasing stimuli so that the pupil dilates and the blood goes to the muscles, to give greater physical vigor.

<h3>ç. Which part of the autonomic nervous system is likely to be active and what is it doing?</h3>

The autonomic nervous system is a part of the nervous system that functions independently of will and consists of neurons that conduct impulses from the central nervous system (brain and/or spinal cord) to the glands, smooth muscle and heart muscle.

<h3>What are the physiological responses of adrenaline binding in the sympathetic autonomic system?</h3>

Adrenaline increases the overall activity of the heart, increasing both the heart rate and the force of contraction. The heart has β1 receptors in both contractile and specialized myocardium. When turning on, a series of cardiac effects can happen.

With this information, we can conclude that the main problem that your central nervous system will try to solve is how to get out of this place.

Learn more about central nervous  in brainly.com/question/17520523

#SPJ1

You might be interested in
Determine whether each example represents continental drift or seafloor spreading
Umnica [9.8K]
Do you have the options?
4 0
3 years ago
Why are metals good conductors of electricity but covalent compounds are poor conductors
Nataly [62]
The electrons in the outermost shell of the covalent compounds are shared by nearby atoms. As there are no free electrons for conducting electricity, the covalent compounds are perfect insulators at absolute zero. As the temperature increases, some electrons move from valence band to conduction band. This gives rise to conductivity. But as the numbers of charge carriers are very low, covalent compounds are poor conductors. On the other hand metals are good conductors cause of their bonding. Metallic bonding consists of a sea of electrons rather than discreet bonds. The free electrons are able to move freely. Since electricity and heat need electrons to move, the bonding promotes conductivity.
5 0
2 years ago
Insulin causes the body's cells to uptake amino acids. <br> a. True <br> b. False
bekas [8.4K]
Answer is: <span>a. True.
</span>The overall effect of insulin is to lower blood glucose and amino acid levels by promoting their cellular uptake and incorporation into glycogen and proteins, respectively.  <span>The net effect of insulin is to decrease blood glucose and amino acids and stimulate the cellular uptake of these molecules and their incorporation into polymers.
</span>Insulin <span>is a </span>peptide hormone<span> produced by </span>beta cells<span> of the </span><span>pancreatic islets.</span>
4 0
3 years ago
The image shows the evolution of a species of fish. A few fish from a population developed different social behaviors and evolve
adell [148]

According to the image, the fish underwent sympatric speciation. The new species of fish had mating seasons that were different from that of the original fish. Because of the differences in mating seasons, the fish underwent reproductive isolation. This mode of isolation would be temporal.

Sympatric speciation happens within a population of an organism that gets isolated reproductively due to differences in their mating periods. This time dependent isolation is called temporal isolation. Example, a fish population can split into two if some of the fishes start mating early in the spring while the rest mate late in the autumn. The spring-mating population will not become compatible to mate with the late-autumn-mating population.

7 0
3 years ago
Read 2 more answers
GET 10PTS EACH true testing means that a serious effort is made to _________.
allochka39001 [22]

Answer:

running back the other two are not as easy to make surely that's they're justified dont gets its taken themselves too getting too they point of the question of how much money they have in their own

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the hardest tree in the world today? Enter your answer in the box below.
    5·2 answers
  • Flowers that are pollinated by the wind usually have smaller petals and sepals than flowers that are pollinated by insects or an
    7·1 answer
  • What is the phenotype of a plant with the genotype RR
    15·2 answers
  • In a diploid organism, there are ___ number of copies of most genes. In a population, there may be many different gene sequences
    8·1 answer
  • Scientists compare two different plant species. In species A, the leaf color is controlled by two alleles. In species B, leaf co
    12·2 answers
  • Which of the following happens when fossil fuels are burned?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Water has the ability to dissolve many<br> substances. This is due to which property of<br> water?
    5·1 answer
  • What are the end products of the HYDROLYSIS of a polysaccharide?
    11·2 answers
  • Make a claim about the types of wastes that the excretory system removes. Support your claim with evidence and explain your reas
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!