1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
4 years ago
11

Why do lunar and solar eclipses not happen every month

Biology
2 answers:
xenn [34]4 years ago
7 0

Answer:

The lunar eclipse occurs when the Moon enters the Earth's shadow. This happens only when the moon and the earth are in same plane. The solar eclipse takes place when moon's shadow falls earth.

This is the reason the solar and lunar eclipse does not takes place every month because there are less chances that the two of them are on the same plane.

So, the lunar and the solar eclipse takes place only when the sun and the moon lies on the same plane so that their shadow falls on each other.

WARRIOR [948]4 years ago
3 0

Answer:

Bottom line: There's no eclipse at every full moon and new moon because the moon's orbit is inclined to Earth's orbit by about five degrees. Most of the time, the sun, Earth and moon don't line up precisely enough to cause an eclipse

Explanation:

A lunar eclipse occurs when the Moon enters the Earth's shadow. A solar eclipse occurs when the Moon's shadow falls on the Earth. They do not happen every month because the Earth's orbit around the sun is not in the same plane as the Moon's orbit around the Earth.

You might be interested in
Wich statement best describes the first stage of cellular respiration? ​
Bad White [126]
The first stage of cellular respiration is most commonly referred to as glycolysis!
5 0
3 years ago
Heating water to produce steam is an example of:
Lady bird [3.3K]

。☆✼★ ━━━━━━━━━━━━━━  ☾  

I'm not sure if there were supposed to be options or not.

However, I believe the answer would be evaporation.

Have A Nice Day ❤    

Stay Brainly! ヅ    

- Ally ✧    

。☆✼★ ━━━━━━━━━━━━━━  ☾

7 0
4 years ago
8(a)(ii) What are the subatomic particles that makes up the nucleus of<br>beryllium?<br>Your answer​
deff fn [24]
4 protons, 5 neutrons, 4 electrons
7 0
3 years ago
What effect does reusing or recycling municipal have on environmental resources?
zimovet [89]

Answer:

Reduces greenhouse gas emissions that contribute to global climate change. Helps sustain the environment for future generations. Saves money. Reduces the amount of waste that will need to be recycled or sent to landfills and incinerators.

Explanation:

8 0
3 years ago
Read 2 more answers
What do saliva, tears, and nasal mucus have in common?
Nezavi [6.7K]

All can destroy bacterial cell walls.

9 0
4 years ago
Read 2 more answers
Other questions:
  • Mutations _____.
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What do homologous and vestigial structures suggest about the process of evolutionary change?
    11·1 answer
  • 1. In an ecosystem with four levels—producers, primary consumers, and two higher-level consumers—describe where the decomposers
    8·2 answers
  • The flowers get nutrients from the frog waste which type of relationship is this
    10·2 answers
  • Plz help meeee!!!!!!!!!!!!!!!!!!!!!!!!!!
    6·2 answers
  • Cells fall into the two (2) largest categories, depending on whether they?
    13·1 answer
  • In pea plants, the tall phenotype is dominant to the dwarf phenotype. A tall plant and a dwarf plant are crossed together. Half
    5·1 answer
  • Is sickle cell anemia caused by genetic or environmental factors
    5·2 answers
  • Match the statement with the correct term
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!