1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denpristay [2]
3 years ago
13

Suppose a point mutation, such as a change from an adenine to a guanine, occurs in the genome of a human sperm cell. The mutatio

n could occur in any region of a gene. The effect of the mutation on the phenotype of the offspring will be determined by where the mutation occurs and its effect on the final gene product. In which of the following scenarios could the mutation alter the phenotype of the offspring? A. The mutation occurs in the promoter and affects the rate of gene transcription. B. The mutation results in a new, dominant allele The mutation occurs in a portion of an intron not responsible for exon splicing.C. The mutation occurs in a gene that controls development and alters differentiation of a cell type during development. D. The mutation occurs in a codon and alters the function of the final protein e mutation occurs in a codon, and the amino acid sequence of the final protein is unchanged.
Biology
1 answer:
yulyashka [42]3 years ago
7 0

Answer:

B. The mutation results in a new, dominant allele

C. The mutation occurs in a gene that controls development and alters differentiation of a cell type during development.

D. The mutation occurs in a codon and alters the function of the final protein

Explanation:

All the above things will change the <u>ultimate expression</u> or phenotype by altering the proteins. Choices B, C, and D will all change the outer functioning.

Choice A only affects the rate of transcription, so it may go faster or slower, but the end product will be the same.

This part that doesn't look like it's one of the choices ("The mutation occurs in a portion of an intron not responsible for exon splicing.") would not affect phenotype, because introns are removed before the RNA is sent out.

Choice E says that the amino acid sequence is unchanged, meaning the protein final product will be the same and the expression will not change.

You might be interested in
How do scientists decide when to change or modify their understanding of a particular topic?​
Natali5045456 [20]

Answer:

they carry out experiments to understand it

Explanation:

Scientists raise hypotheses which are tested by experiments made under controlled conditions in order to explain a particular topic. When a hypothesis is confirmed by the experimental data, the evidence obtained from this experiment provides the basis to increase the scientific knowledge about a particular issue. In consequence, experimentation can be considered as a critical step in the scientific method and research aims to advance knowledge of a particular phenomenon by confirming a hypothesis, which must be testable (i.e. verifiable as a result of further experimentations).

6 0
3 years ago
Hi, can someone answer this I need this as soon as possible? I would really appreciate it.
hoa [83]
So they respond by releasing hormones that stimulate the body to retain sodium and water. Blood vessels fill with additional fluid, and blood pressure goes up. The narrowing in one or both renal arteries is most often caused by atherosclerosis, or hardening of the arteries.
4 0
3 years ago
Male body cells only have one X chromosome, while females have two X chromosomes. It is hypothesized that if both X chromosomes
Dmitry [639]

C X-inactivation "switches off" one of the X chromosomes.

Explanation:

3 0
3 years ago
10.
Dafna1 [17]
Phospholipids are not in the animal cell
7 0
3 years ago
Read 2 more answers
The four types of macromolecules in cells are nucleic_________<br> lipids, proteins, and_____
brilliants [131]

The four types of macromolecules in cells are nucleic acids, lipids, proteins, and carbohydrates.

8 0
2 years ago
Read 2 more answers
Other questions:
  • What organ is important in processing substances after they are absorbed during digestion?
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Pastel consists of pigment bound with a ______ binder.
    11·2 answers
  • What's 6 heavy metals that can be taken up by plants
    13·1 answer
  • -give an animal that lives in mountain <br>-give 3 adaptations of this animal​
    9·1 answer
  • an organism had 8 chromosomes in its body cells. how many chromosomes will be in the body cells of the offspring?
    9·1 answer
  • What was the purpose of placing the drop of distilled water onto the slide before smearing the bacterial colony onto the slide?
    5·1 answer
  • Which of the following could lead to a loss of habitat?
    12·2 answers
  • ¿cómo es el lugar al que llegó Alicia?,¿cuáles son los sentimientos o sensaciones que experimenta?Explicamos​
    11·1 answer
  • Bob...........................
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!