1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
13

Every HIV particle contains two RNA molecules. If two genes from one RNA moleculebecome detached and then, as a unit, get attach

ed to one end of the other RNA moleculewithin a single HIV particle, which of these is true?A) There are now fewer genes within the viral particle.B) There are now more genes within the viral particle.C) A point substitution mutation has occurred in the retroviral genome.D) The retroviral equivalent of crossing over has occurred, no doubt resulting in aheightened positive effect.E) One of the RNA molecules has experienced gene duplication as the result oftranslocation.
Biology
1 answer:
natita [175]3 years ago
5 0

Answer:

One of the RNA molecules has experienced gene duplication as the result of translocation.

Explanation:

Translocation and duplication are some of the structural abnormalities in the chromosomes that may even cause certain genetic disorders. Duplication is the presence of a genetic segment for more than one time in the chromosome. The repeated genetic segments are mostly present in the tandem pattern. When a chromosome fragment breaks off and attaches to a non-homologous chromosome, it is called translocation. It leads to the deletion of a genetic segment in one chromosome and duplication in the other.

According to the given information, a genetic segment bearing two genes is detached from one RNA and gets attached to the other RNA molecule of the HIV genome. Therefore, the RNA molecule has undergone translocation and has lost a genetic segment while the other has gained a genetic segment (duplication) due to translocation.

You might be interested in
DNA is contained in a different way in prokaryotic cells than it is in eukaryotic cells because
Musya8 [376]
In eukaryotic cells DNA is in a nucleus where are in prokaryotic cells DNA is free
6 0
3 years ago
Read 2 more answers
If the amino acin the protiens of 2 organisms are similar, why will their DNA also be similar?
ladessa [460]
If I’m not incorrect, DNA is made from amino acids
6 0
3 years ago
Cells are circular, hollow structures that serve as building blocks of living things. fact or opinion​
MariettaO [177]

Answer:

<em><u>FACT</u></em>

Explanation:

<h3>Cells as Building Blocks</h3>

<h3>A living thing, whether made of one cell (like bacteria) or many cells (like a human), is called an organism. Thus, cells are the basic building blocks of all organisms</h3>
7 0
2 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
What are 3 ways the scientific community reviews scientific results
ira [324]
Communicate , experiment , hypothesis, collect data
8 0
3 years ago
Other questions:
  • Why does the hatchery not use formaldehyde to clean eggs<br> i need it fast please
    9·1 answer
  • One of the monosaccharides is a building block of a plant's cell wall. It is
    7·2 answers
  • Scientific models depend on critical thinking and argumentation. One example is the Inside-Out Model of ocean formation. What is
    8·2 answers
  • As an infant, the ability to produce is......?
    8·1 answer
  • What question did Hardy and Weinberg want to answer?
    9·2 answers
  • PLS HELP ASAPPPPPPPPPPPPPPPP
    10·1 answer
  • What is la Nina <br><br><br><br> (in weather science)<br><br><br> plz help :C
    12·2 answers
  • The nervous system is in the body's ____ network
    13·2 answers
  • How do the geography and geographical features of your area affect the temperature?
    8·1 answer
  • Using fertilisers can lead to algae build up in ponds and rivers.<br><br> Why is that bad?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!