1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jekas [21]
2 years ago
14

when male and female gamete are produced by different parents unite to form zygote this type of reproduction is termed​

Biology
1 answer:
riadik2000 [5.3K]2 years ago
5 0

Answer:

Sexual reproduction.....

You might be interested in
The presence of a specific trait is genetically inherited. There are only two possible outcomes for this trait: An individual ei
Igoryamba

Answer:

D) Each parent contributes one allele for this trait  

Explanation:

All traits of individuals are determined by specific genes of that trait. For example, there is a certain gene for height, certain gene for eye color, face shape etc.

Genes are the units of hereditary, and for every trait there is one gene in every organism. However, one gene is present in two alternative forms called alleles in an organism. For example: There is a trait height, a person has two alleles for the height gene, one allele is for short height, and other allele is for tall height. The trait of tallness is dominant over the trait of shortness, Therefore, this person will have tall height.

Now the alleles are transmitted from parents to offspring. Every parent contributes one allele for a specific trait, in the process and transmit it to offspring.

The allele which will be dominant will be expressed while the one that is recessive will e suppressed.

Therefore, option D is the right answer.

Hope it helps!

6 0
3 years ago
PLS HELP ASAP!!! I WILL NAME BRAINLIEST!!
atroni [7]

Answer:

either B or D because at the end Whilst the ultimate outcome of the lytic cycle is production of new phage progeny and death of the host bacterial cell, this is a multistep process involving precise coordination of gene transcription and physical processes.

8 0
3 years ago
Speciation or the formation of a new species can be the result of:
stich3 [128]
Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge. In allopatric speciation, groups from an ancestral population evolve into separate species due to a period of geographical separation.
5 0
2 years ago
According to MacKinnon, how many human genes are there?
mafiozo [28]
I think its 300 genes
7 0
3 years ago
What is a function of hydrochloric acid in the stomach nutrition?
Mandarinka [93]
The primary role of hydrochloric acid is to sterilize the food you eat and to prevent harmful bacteria from entering the GI tract. HCL also triggers the release of enzymes such as pepsin which are essential for the digestion of protein.
8 0
2 years ago
Other questions:
  • What are the 2 main classes of organelles
    7·1 answer
  • Dehydration increases the risk of thrombus formation.<br> a. true<br> b. false
    14·1 answer
  • Nancy is in her building elevator going down to the lobby when the elevator stops suddenly between floors, and the doors won't o
    13·1 answer
  • Most of the volcanic activity on earth occurs where
    7·1 answer
  • In which part of a coal-burning power plant is the coal actually burned? boiler condenser pulverizer
    13·2 answers
  • _____ refers to the natural resources and services that keep us alive and other species alive.
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Oxygen and air are? Abiotic or biotic 
    8·2 answers
  • How does conjunctivitis impact the community ?
    12·1 answer
  • Specific neurons being used in playing tennis are given more stimulation for an extended amount of time with repeated motor prac
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!