1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hichkok12 [17]
3 years ago
7

What kinds of organisms require telomerase?

Biology
1 answer:
Anvisha [2.4K]3 years ago
8 0
Eukaryotes contain linear chromosomes and therefore require telomerase to prevent loss of the ends of the chromosomes
You might be interested in
What type of mutation in nucleotide 4 would produce the same amino acid?
g100num [7]
Most likely a silent mutation. Silent mutations are mutations in DNA that do not have an observable effect on the organism's phenotype because the same amino acid is produced regardless of the change in the nucleotide sequence by the mutation.
8 0
3 years ago
What are some ways in which the structure of a compound influences its function?
Art [367]
 structure of a compound influences its function in many ways like we take example of phospholipid bilayer  1. The fact that the tails are hydrophobic means that they do not interact with water. When a bunch of phospholipids are floating around in water, they try to arrange themselves in a bilayer that shields the hydrophobic parts from water-based, or aqueous, surroundings.

2. The heads are hydrophilic and can then interact with water and other polar or charged substances on either side of the bilayer. The bilayer acts as a barrier that allows cells to maintain internal conditions that are different from external conditions, which is monumentally important for cells to operate properly. 

3. Phospholipids demonstrate the intersection of structure and function in another way, too. We already know that fatty acids can be saturated or unsaturated and that unsaturated fatty acids have bends in their chains. Those bends prevent fatty acids from packing close.

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Field mice in beach mice are closely related species. The Field mice are various shades of brown in the beach mice or later 10 a
wariber [46]

Answer:

The process of natural selection is acting on <u>Field mouse individuals</u> where as evolution is occurring on <u>Field Mouse population. </u>

Explanation:

As the problem shows, the field mice are the ones that natural selection is acting on, but only the ligher shade ones. Because the lighter shade individuals are more likely to survive in the beach because they blend with the environment.

Evolution occurred on the field mouse population because if you read the script in the end, they were able to successfully reproduce. This means that they evolved in such a way that they were able to survive in their new environment. (most likely carrying on the trait of light-colored fur)

Natural selection acts on traits, phenotypic traits, favorable to the environment. Evolution occurred because of the natural selection, because the favored trait enabled the organism to adapt to the environment.

4 0
3 years ago
What is an estuary? How and why does the salinity of estuaries vary?
olya-2409 [2.1K]

Answer:

Salinity in an estuary varies according to one's location in the estuary, the daily tides, and the volume of fresh water flowing into the estuary. In estuaries, salinity levels are generally highest near the mouth of a river where the ocean water enters, and lowest upstream where freshwater flows in.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • C6H12O6 is a type of .Glucose has _____ carbon atoms. A) 12 B) 6
    10·2 answers
  • What is sustainability?
    13·2 answers
  • Which term is the name of the diploid stage of the plant life cycle?
    8·1 answer
  • What could serve as a dependent variable in an investigation of salt's effects on cheek cells?
    13·1 answer
  • Me no know the ans, pls hlp meh!
    10·2 answers
  • What enough stress build up in a bottle rock the rock brakes causing a
    15·1 answer
  • What are hydrogen bonds
    15·1 answer
  • In which way is primary succession similar to secondary succession?
    5·1 answer
  • Once water vapor has been released into the atmosphere, it rises and cools, turning back into liquid. What is this process calle
    7·2 answers
  • Explain the relationship between these terms photosynthesis chlorophyll thylakoids chloroplasts
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!