1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ollegr [7]
3 years ago
5

Which of the following is NOT a type of carbohydrate? * wax sugar starch cellulose

Biology
1 answer:
Pepsi [2]3 years ago
4 0
Wax is not a type of carbohydrate it is a lipid (fat).
You might be interested in
Plants also give off wastes as gases. What structures help plants do this?
Zielflug [23.3K]
The structure that helps plants give off wastes as gases is called stomata
6 0
3 years ago
What substances are produced during photosynthesis?
dusya [7]
Glucose or sugar are produced during photosynthesis.
3 0
3 years ago
Read 2 more answers
Which kingdom includes autotrophic and heterotrophic, unicellular and multicellular organisms? A) Animalia B) Fungi C) Plantae D
Nonamiya [84]

Its D Protista not B

6 0
3 years ago
Read 2 more answers
What leads to long-term immunity in mammals? A. Exposure to an antigen B. Action of an antibody C. Barriers
jeyben [28]
Exposure to antigen as this input brings the total to five answers. y or n
7 0
3 years ago
Which of the following statements is true?
natulia [17]
While all of these statements may be true, the only one that is always true is D, the last one. Evolution is a VERY slow process, occuring over many millions of years, according to many scientists.
5 0
3 years ago
Read 2 more answers
Other questions:
  • According to the cell theory, which describes cells?
    5·2 answers
  • Does anyone know what breed of cat this is?
    13·1 answer
  • Higher levels of "heavy" oxygen in ocean water indicate ___ climates, whereas lower levels of "heavy" oxygen in the oceans indic
    10·1 answer
  • True or false: All solids, liquids, and gases have density
    9·2 answers
  • Which of the following is true regarding catabolic pathways? They consume energy to build up polymers from monomers. They lead t
    13·1 answer
  • Me walking into school when i know im dress code
    11·2 answers
  • How are cancers usually named.
    15·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Explain why plants with normal leaves grow more than plants with variegated leaves.
    6·2 answers
  • Answer soon as possible would be appreciated!!!!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!