1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
3 years ago
15

What causes the phases of the Moon as seen from Earth?

Biology
2 answers:
Korolek [52]3 years ago
6 0
The answer is A. <span>Light from the Sun reflects off the Moon as it orbits Earth. Hundreds of thousands of miles lie between the Moon and Earth.</span>
laiz [17]3 years ago
4 0

What causes the phases of the Moon as seen from Earth?  

The correct answer is option A.

A. Light from the Sun reflects off the Moon as it orbits Earth. Hundreds of thousands of miles lie between the Moon and Earth.

Explanation:

The phases of the moon depends on its position with respect to the sun and the earth. When the moon revolves around the earth, we see the bright parts of the moon's surface at different angles. These are called phases of moon.

You might be interested in
Where are the three seismographs used to find the epicenter of this earthquake located?
8090 [49]

Scientists use triangulation to find the epicenter of an earthquake. When seismic data is collected from at least three different locations, it can be used to determine the epicenter by where it intersects. Every earthquake is recorded on numerous seismographs located in different directions. Each seismograph records the times when the first (P waves) and second (S waves) seismic waves arrive. From that information, scientists can determine how fast the waves are traveling. Knowing this helps them calculate the distance from the epicenter to each seismograph.

To determine the direction each wave traveled, scientists draw circles around the seismograph locations. The radius of each circle equals the known distance to the epicenter. Where these three circles intersect is the epicenter.


7 0
3 years ago
Read 2 more answers
1. An example of a non-renewable resource would be
Nina [5.8K]

Answer:

D. Library Book

Explanation:

This is because library books can not be recycled. Sorry if my answer is wrong, just trying to help.

8 0
3 years ago
To which kingdom does this species mostly likely belong?
Varvara68 [4.7K]

Answer:

Animal kindom

Explanation:

the species most likely belong to the animal kindom

5 0
3 years ago
**Easy**quick**extra points**
12345 [234]

Answer:

A Trust me I'm a genius

Explanation:

I pretty sure it would only make sense to me

6 0
3 years ago
Read 2 more answers
Foods that are low in sodium and rich in potassium include
Margarita [4]
Potassium holds an important function in both cell and energy-related functions. Potassium is considered to be one of the important blood minerals. Potassium regulates the balance of both water and acid in our blood and body tissues. Food which are high in potassium include white beans, spinach, plain yogurt, broccoli, sweet potato milk, bacon, oranges and many more. One should avoid the excessive intake of salt because too much intake of salt in the body may cause complications or illnesses in our body. Some illnesses caused by too much salt in the body are fluid retention, high blood pressure, Kidney problems and heart failure.
8 0
3 years ago
Other questions:
  • Which type of cell would probably provide the best opportunity to study lysosomes?
    12·1 answer
  • Be-29 where may untreated human waste be dumped overboard while on inland waters?
    7·1 answer
  • Can someone help me with 8 &amp; 9? I took a guess but I'm not too sure, ty
    6·1 answer
  • In a study of genetic variation of the Graceland gene, a researcher finds that there are two alleles in a population. In a large
    8·1 answer
  • After the drought of 1977, researchers hypothesized that on the Galápagos island Daphne Major, medium ground finches with large,
    10·1 answer
  • What does bacteria in soil feed on?
    7·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • which explanations accurately describe how cell structures interact in order to maintain homeostasis? select all that apply.
    15·1 answer
  • Can u pls help me gosh 17 if u get it right
    14·1 answer
  • You need to examine the internal anatomy of both lungs at the same time but can make only one cut. Which plane or planes of the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!