1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
5

Which factor affect the rate of erosion​

Biology
1 answer:
soldi70 [24.7K]3 years ago
6 0

Answer:

air temperature, precipitation, wind, and other factors

Explanation:

You might be interested in
What are some negatives and some positives of coastal development?
zzz [600]

Answer:  Positive: Coastal areas help prevent erosion; filter pollutants; and provide food, shelter, breeding areas, and nursery grounds for a wide variety of organisms.

Negative: Added to this are impacts such as increased erosion due to coastal development, increased pollution, and increased boat traffic - all of which lead to further habitat loss and put increased pressure on marine species. ... Other coastal developments can also harm sensitive marine habitats and species.

Explanation:

5 0
2 years ago
Sodium and potassium ions are essential for muscle contractions of the heart. The ions are transported using a pump, which obtai
emmasim [6.3K]
The sodium and potassium ions are transported using a sodium potassium pump the process of moving sodium and potassium ions across the cell membrane.
4 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
2) During Telephase I the 2 daughter cells that are created are Haploid, not a
Luba_88 [7]

Answer:

True

Explanation:

4 0
3 years ago
Read 2 more answers
Which of the following describes the variable that responds to change
lara31 [8.8K]
The Dependant Variable is the one responding to change.
Control Variables are controlled by you, and you influence the Independent Variables.

What do you mean by following?
7 0
2 years ago
Other questions:
  • Suppose you could selectively prevent production of a-amylase or oligo-1,6-glucosidase in an organism that normally hydrolyzes s
    15·2 answers
  • What is mimicry ? How does it benefit the animal ?
    13·1 answer
  • Why is it important that alveoli are only one cell layer thick?
    9·1 answer
  • Both photosynthesis and cellular respiration are part of the carbon cycle. Which statement best compares these two processes? Bo
    12·2 answers
  • Where do sperm go after leaving the ejaculatory duct?
    12·2 answers
  • Watson and Crick's model of DNA replication is called
    14·1 answer
  • The graph shows the speed of a car during a trip along the highway. What can you say, in general, about the speed of the car?
    14·2 answers
  • Which of the following bacteria are important in degrading many compounds that most other microbes are unable to break down, is
    8·1 answer
  • Water is able to dissolve more substances than any other liquid. This is an example of which property?
    15·1 answer
  • Problem 10.23 in book: There are 3.4 billion base pairs lined up end to end in one human DNA molecule, which contains the entire
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!