1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
13

Which energy level has the least energy? n=1 n=3 n=5 n=7

Biology
2 answers:
Ganezh [65]3 years ago
6 0

Answer:

The answer is n=7

lisabon 2012 [21]3 years ago
5 0

Answer:

n = 7

Explanation:

The Energy of a system decrease through the levels. Is simple to understand that:

1. All energy cames from sun.

2. Organisms that can absorve that energy acumulates X quantity. The more comum way to do that is the photosynthesis, which turns solar energy into glucose, basically. (Equation of photosynthesis: 6H2O + 6CO2 = C6H12O6 + 6O2)

3. The first heterotrofic organism eats a plant, for example. Then he gets a part of that energy, aproximately 0,3X - the efficiently variates for each organism, but it's low. For example, we need to took 30 Kcal to use 100 Kcal from a common protein. And we need to lose more energy for every process that we will do in our body. Remember, or now know, the second law of termodinamics: is impossible to fully convert the ceded energy into WORK in a open system.

4. The next organism eats the first, getting a part of his energy. 0,3 x 0,3X

<em>So, as this process repeats for all organisms, we can easily conclude that the last organism has the least energy.</em>

You might be interested in
All of the following are true of most vitamins EXCEPT A. they enhance enzymatic activity. B. they are inorganic molecules. C. th
Elenna [48]

Answer:

They are in organic

Explanation:

Vitamins are organic compounds derived from plants or animals that are needed in the body at small quantities.

They help in the body's metabolism since they enhance enzymatic activities and can act as co-factors.

They are essential for good health such as vitamin A helps in improving eye sight.

Lack of certain essential vitamins can lead to disease ,lack of vitamin D can lead to Rickets.

5 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Do you think the processes that form and shape the small stream bed are similar to those that form and shape the Grand Canyon? W
NARA [144]

Answer:

Yes.

Explanation:

Yes, the processes that formed and shaped the small stream bed are similar to the process of formation of Grand Canyon because both small stream bed and Grand Canyon formed by flowing of river. Water flows through rocks and finally formed Colorado River. so we can say that both small stream bed and Grand Canyon formed due to the same process i. e. flowing of water.

7 0
2 years ago
The Venus fly trap is a plant that has a unique system by which the traps and breaks down its prey unsuspecting a insects in lan
LenaWriter [7]

Answer:

so... whats the question?

Explanation:

8 0
2 years ago
Read 2 more answers
Explain the precautions for immunizing children with Bruton's agammaglobulinemia.
topjm [15]

Answer:

Avoid using killed vaccine for administration.

Explanation:

Bruton's agammaglobulinemia may be defined as the X linked disorder that affects the immune system of an individual. This disease is mainly caused by the mutation in the gene responsible for coding the  Bruton tyrosine kinase.

The children suffering from this disease require special immunization and some precaution must be followed before immunizing them. These patients are not allowed to immunizes with the live vaccines as these vaccines can evoke the immune response strongly and child may get infected by the disease. The individual should not given immunosuppressive drugs or corticosteroids.

Thus, the answer is avoid using killed vaccine for administration.

8 0
3 years ago
Other questions:
  • 1. How many grams are equivalent to 0.54 kilograms​
    8·1 answer
  • Refusal techniques are:
    15·1 answer
  • The motion permitted at a joint ranges from ____________ , such as where some skull bones interlock at a suture, to ____________
    14·1 answer
  • This reaction is known as aerobic respiration. Explain why it is described as "aerobic"
    7·2 answers
  • A star is said to be born when _____.
    10·2 answers
  • The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that
    8·1 answer
  • HURRY ON A ASSIGNMENT I WILL GIVE BRAINLIEST CHECK ALL THAT APPLY
    14·2 answers
  • How is Bohr's atomic model different from Rutherford’s model?
    5·2 answers
  • ________ forms when water vapor in a cloud is converted into ice crystals. *
    13·2 answers
  • The heart of an embryo starts to pump blood by the ________.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!