1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
13

The size of soil particles will affect how fast water passes through and also the amount of space between particles. This descri

bes
Biology
1 answer:
igomit [66]3 years ago
5 0

The answer is; Porosity which affects soil texture

The largest particle size is referred to as sand,  medium is silt, while the small particles are clay. Soil texture is determined by the ratio of these three in its mixture. Soil with a higher proportion of clay becomes waterlogged easily when it rains. The right kind of soil for farming is loam because it is well drained.


You might be interested in
A point mutation that creates a premature stop codon is called a _____ mutation.
PolarNik [594]
I am pretty sure that a point mutation that creates a premature stop codon is called a synonymous  mutation. It also can be called silent mutation, if you have it in you option list, feel free to use it, it is the same. That will definitely help you.
3 0
3 years ago
DNA and RNA are molecules involved in _____.
Degger [83]
Well, DNA and RNA molecules are both involved in the process of Protein Synthesis whether it be Prokaryotic and or Eukaryotic Protein Synthesis.
7 0
3 years ago
A student would like to determine how heating a liquid changes its volume. The student hypothesizes that the liquid will increas
Elena-2011 [213]

Answer:

C

Explanation:

You must know the volume before and after to compare results.

4 0
3 years ago
Read 2 more answers
5. Besides being part of the composition of bone, why else do mammals need calcium?
Rashid [163]

Answer:

It's important for the contracting muscle

Explanation:

8 0
3 years ago
Mike and Veronica are expecting their first child and they are nervous about all of the possible health issues a baby can face.
Tcecarenko [31]

The possibles is knowing the Medical history of the family which can

tell you what hereditary diseases the child boy/girl might be strangely have which could tell the doctors what to look for and how to solve the problem if it can be impossible to be fixed, it will also prepare the parents for what their expectations are for the their child and not be so surprised about the whole situation.

conmon disorders=heart disease, high blood pressure, stroke, certain cancers and more.. other..

~Have a nice day~

8 0
3 years ago
Other questions:
  • What type of wave is sound????????????????? help
    10·1 answer
  • When a parent cell makes several nuclei and divides to make several daughter cells, it is called _____.
    9·2 answers
  • What are homozygous and heterozygous and where can it be found?
    12·2 answers
  • Nuclear energy is a useful source of power but has disadvantages. What is a disadvantage of nuclear energy?
    7·2 answers
  • What is the difference between jet streams and global wind belts
    15·1 answer
  • One feature that amphibians and humans have in common is
    8·1 answer
  • Any tree can breed with any other tree, so they are all of the same species. True or false?
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • In at least 100 words, construct an explanation that predict an organism's ability to
    15·1 answer
  • How do yhu search up someone profile
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!