1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
2 years ago
8

A Low frequency will have a ___________wave length.

Biology
2 answers:
Orlov [11]2 years ago
5 0

Answer:

long wave length

Explanation:

o-na [289]2 years ago
4 0

Answer:

Longer

Explanation:

Because it's slow

You might be interested in
Which single factor would most likely account for this trend?
goldenfox [79]
For what trend??????????
7 0
3 years ago
Neurons may be classified according to several characteristics. Which of the following is correct? A. Group A fibers are mostly
den301095 [7]

Answer:

Option (B).

Explanation:

Neurons or nerve cell are the basic structural and functional unit of the nervous system. Fibers are the thread like long projection of the nerve cells.

Neurons are classified into three fibers- Group A fibers, B fibers and C fibers. The group C fibers cannot capable of doing the saltatory conduction of the nerve impulse because they are unmyelinated.

Thus, the correct answer is option (B).

3 0
3 years ago
During the _____ month the eyes, ears, nose, jaw and neck form along with the arms, legs, fingers, and toes.
Rudiy27

Answer:

During the 3rd month the eyes, ears, nose, jaw and neck form along with the arms, legs, fingers, and toes.

Explanation:

3 0
1 year ago
A hawk is a predator for mice. what will happen if the hawk population decreases due to hunting by humans?
Mazyrski [523]
The mouse population will increase
5 0
3 years ago
Read 2 more answers
To measure the amplitude of a wave you should measure...
Alexxx [7]

Answer:

<u><em>C.)</em></u>  <em>Crest to trough</em>

8 0
3 years ago
Other questions:
  • Which of the following is true about differentiated cells?
    6·1 answer
  • Describe how C. parvum obtains the glucose it needs for glycolysis after it has infected another cell. Explain the role of lacta
    11·1 answer
  • On the electromagnetic spectrum,
    8·1 answer
  • Each element on the periodic table is represented by a:
    14·1 answer
  • Put the following parts of a river in order from beginning to end:
    14·1 answer
  • In the experiment, you will determine whether adding nutrients to the soil changes the community of plants growing there. This i
    12·2 answers
  • Help plz
    5·2 answers
  • PLEASE HELP ASAP
    15·2 answers
  • Which of the following is NOT a course that nurse anesthetists would take in preparation for their new care
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!