1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melisa1 [442]
3 years ago
7

What happens to glucose inside a cell during cellular respiration?

Biology
1 answer:
alexdok [17]3 years ago
7 0
I think the answer is c.
You might be interested in
What are the two foods that the deer eating
Zielflug [23.3K]

Answer:

<em>Deer are herbivores</em>

Explanation:

<em>Deer are herbivores, that is, they eat plants. The diet of a wild deer includes such things as grass, bark, twigs, berries, young shoots and other vegetation. Deer eat about two pounds of dry food each day for every 100 pounds of body weight.</em>

6 0
4 years ago
Read 2 more answers
Gizmos Student Exploration: Photosynthesis Lab answer key pleaseeeee
mojhsa [17]
Gizmo student is psychologically chemically imbalanced and a brain surgeon
8 0
3 years ago
Which life cycle describes a plant that reproduces asexually and sexually? A. egg + sperm → embryo → adult with all its chromoso
Minchanka [31]
Life cycle describes a plant that reprodueces asexually and sexually.
4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Describe how greenhouse gases contribute to climate change
vladimir1956 [14]
Greenhouse gases arise naturally, and are part of the make-up of our atmosphere. Earths conditions are just right to allow life, including us, to flourish. Part of what makes Earth so amenable is the naturally-arising greenhouse effect, which keeps the planet at a friendly 15 °C (59 °F) on average. But in the last century or so, humans have been interfering with the energy balance of the planet, mainly through the burning of fossil fuels that give off additional carbon dioxide into the air. The level of carbon dioxide in Earth’s atmosphere has been rising consistently for decades and traps extra heat near the surface of the Earth, causing temperatures to rise.

3 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following is fact based science rather than a part of a personal belief system
    6·2 answers
  • Which technology do environmental scientists use to photograph and report poaching activities
    9·2 answers
  • What are six physical changes that matter can go through?
    5·1 answer
  • Examine the diagram of the cell cycle.
    13·1 answer
  • Describe one way that a decrease in species diversity can affect an ecosystem
    12·1 answer
  • The endocrine system uses chemical messengers called *<br> -glycogen<br> -hormones<br> -starch
    5·1 answer
  • The dermal layer is blank layer of the plant
    14·2 answers
  • What is cyclone??<br><br>Thx aliya for these much thx​
    7·2 answers
  • Which of the following is the most likely reason why most smallholders avoid precision agricultural technology?
    10·1 answer
  • PLEASE HELP NO LINKS WILL REPORT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!