1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]3 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
Which of the following is a geographical limit?
emmainna [20.7K]
The answer would be C.mountains
7 0
3 years ago
Read 2 more answers
a shoreline mussel species has a population density of one organism per square meter. will all mussels be found one meter apart.
Ahat [919]
No.
This method of stating population density is carried out by counting the number of specimen in a given area and then dividing the number of specimen by that area. This does not mean that each specimen is one meter apart. Some regions may have no specimens for multiple meters while other regions may have multiple specimen in the same meter. The population density gives us an average value.
8 0
3 years ago
With increasing age comes a greater chance of a woman having been exposed to damaging environmental agents such as drugs, chemic
allsm [11]
<h2>Down Syndrome</h2>

Explanation:

Down syndrome is a genetic disorder caused when abnormal cell division results in an extra full or partial copy of chromosome 21

  • Down syndrome is a genetic disorder caused when abnormal cell division results in an extra full or partial copy of chromosome 21
  • Down syndrome is usually caused by an error in cell division called nondisjunction which results in an embryo with three copies of chromosome 21 instead of the usual two
  • Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separates
  • With development in embryo the extra chromosome is replicated in every cell of the body;this type of Down syndrome which accounts for 95% of cases is called trisomy 21
  • Maternal age is the only factor that has been linked to an increased chance of having a baby with Down syndrome resulting from nondisjunction;here environmental agents such as drugs, chemicals, and radiation act as mutagens which induce mutation in the fetus
5 0
3 years ago
Read 2 more answers
a rational expression has been simplified below. (x-5) (x+1)/3(x+1) = x-5/3 for what values of x are the two expressions equal​
Stella [2.4K]

Answer:

Apparently 0 is the answer which makes sense

Explanation:

https://www.tiger-algebra.com/drill/(x-5)(x_1)/3(x_1)=x-5/3/

4 0
3 years ago
Read 2 more answers
Dsadasd das sad afsasdasdsa?
andrey2020 [161]

I am sorry what?????

what language is this?

7 0
3 years ago
Other questions:
  • Can you help me pleasseee!! Thank you!
    9·2 answers
  • What is am enzyme used for ?
    8·1 answer
  • Which is characteristic of a mineral?
    6·2 answers
  • What two conclusions makeup Mendel's law of segregation
    12·1 answer
  • I HAVE 2 QUESTIONS!!!
    12·1 answer
  • Which describes slate? non-foliated igneous does not split into layers grains arranged in parallel layers
    7·1 answer
  • How can energy be converted into different forms?
    8·1 answer
  • (PLESE HELP ME) If a force of 20.0 N is used to lift a box a distance of 0.5 m, how much work is done? (INCLUDE THE UNIT for wor
    5·2 answers
  • The two main functions of the lymphatic system are a producing hormones that regulate the immune system and coagulating blood. b
    11·1 answer
  • Which muscle tissue type has short, branching cells?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!