1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
A population of rhinos was separated by a large river.
maria [59]

Answer:

B

Explanation:

8 0
3 years ago
In the human body, sodium—a component of salt—balances fluids, such as water, in the body. Explain how the onion experiment show
Bogdan [553]

Answer:

The salt worked like sodium on the onion.

Explanation:

5 0
2 years ago
What name is given to elements with the same number protons but differering numbers of neutrons?
Natali5045456 [20]
~Hello there!

Your question: What name is given to elements with the same number protons but differing  numbers of neutrons?

Your answer: Istopes is the name given to the elements with the same number of protons but differing number and neutrons.

Any queries ^?

Happy Studying!
7 0
3 years ago
The population of frogs in a pond ecosystem is increasing. The population of flies will most likely do what?
34kurt
Decrease as the more frogs there are the more flies  will be eaten so that means the flies will decrease.Also if the flie population gets low enough the frog population would shrink too to balance it.

6 0
3 years ago
5 facts about Anaphase Mitosis ?
Klio2033 [76]
The sister chromatids are then pulled apart by the mitotic spindle which pulls one chromatid to one pole and the other chromatid to the opposite pole.

The chromosomes line up neatly end-to-end along the centre (equator) of the cell.
The centrioles are now at opposite poles of the cell with the mitotic spindle fibres extending from them.
The mitotic spindle fibres attach to each of the sister chromatids.

The DNA in the cell is copied in preparation for cell division, this results in two identical full sets of chromosomes?.
Outside of the nucleus? are two centrosomes, each containing a pair of centrioles, these structures are critical for the process of cell division.
6 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following vitamins is used to construct the coenzymes NADH and NADPH?
    13·1 answer
  • Jack is examining a plant stem slide under the microscope. He can distinctly identify the epidermis, sclerenchyma, and phloem ti
    11·1 answer
  • Why is it important to identify the presence of fecal contamination in the enviorment?
    8·1 answer
  • By what factor (how much) does the milli- unit differ from the centi- unit?<br> earth science
    14·1 answer
  • 4. Frozen water is less dense than liquid water, Explain why this is important for aquatic
    12·1 answer
  • What is the correct order of classification from largest (most organisms) to smallest (least organisms - most specific)?
    15·1 answer
  • Can anyone help me? I’m stuck
    7·2 answers
  • Water, carbon dioxide, oxygen, and some other substances can pass through the cell membrane because...
    15·1 answer
  • A population of beetles is kept in a controlled ecosystem. No beetles are
    13·2 answers
  • What animal has green bones?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!