1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]3 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
Can parent's go too far in supporting their children's dreams
motikmotik
Yes,  of course! They may not always realize that instead of helping sometimes they're harming.  They could push their child into a school that can help them for the future even though they want to try a different school. They can annoy their child and they'll get sick of it and lose interest in their subject. 
6 0
3 years ago
A protein is a polymer consisting of a specific sequence of
valentina_108 [34]

Answer:

amino acids

Explanation:

one of the bases or examples of proteins

3 0
3 years ago
Read 2 more answers
Match each form of energy with its description​
PolarNik [594]
The energy with the form
7 0
3 years ago
What is the waste product of photosynthesis<br> A. O2<br> B. CO2<br> C. H2O<br> D. C6H12O6
Digiron [165]
A bc it takes in CO and releases oxygen
4 0
4 years ago
Read 2 more answers
What do fossils give clues about? <br> 3 Clues
Slav-nsk [51]
Anatomical structure, possible diet, and reproduction evidence.
4 0
3 years ago
Other questions:
  • An antibiotic that attacks the LPS layer would be expected to have a broad spectrum of activity, effective against Gram negative
    8·1 answer
  • Which part of a neuron acts like an antenna to receive messages from other neurons and transmits these messages toward the cell
    12·1 answer
  • Please help. Those are the only three options
    6·1 answer
  • In word is the genus and which is the species of this scientific
    12·1 answer
  • Why is pH an inverse measure of the concentration of hydronium ions in a solution? Any help is appreciated:)
    11·1 answer
  • Most sex-linked, recessive traits-including hemophilia and color blindness-appear in males. This phenomenon is BEST explained by
    7·1 answer
  • Around the edges of many dry areas, sensitive ecosystems depend on local plant life to maintain cool, moist conditions. When hum
    9·1 answer
  • Which statement best compares aerobic and anaerobic
    11·1 answer
  • What macromolecules and biomolecules are critical for<br> cellular respiration to occur?
    9·1 answer
  • An effective short-term remediation strategy for the pond would be to.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!