1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
The most significant greenhouse gas emitted in large quantities by human society is
Lynna [10]
The primary and most significant greenhouse gas emitted from human activities is carbon dioxide. Burning of fossil fuels is the major cause of increased carbon dioxide emission.The burning of coal, oil, and natural gas is an important energy source to produce electricity.
7 0
3 years ago
Select all that apply. which of the following are things you can do to reduce pollution? purchase products made from recycled ma
k0ka [10]
Purchase products made from recycled material
Recycle used Products
and 
Walk instead of drive

Driving releases pollutants in the air and when we use gas and oil we are using lots of our natural resources and cutting them down day by day.
3 0
3 years ago
Read 2 more answers
What would happen if a cell couldn't complete cell metabolism?
tatiyna
They would kill the rest of the cells
8 0
3 years ago
In a plant cell wall the layer that is between a membrane, adding additional protection and support; not found in all plant cell
Tomtit [17]

Answer: SECONDARY CELL WALL.

Explanation: When cell wall grow,it becomes thickened,then it further deposits new layers of a different material (different from that of the primary cell wall) from where secondary cell wall is formed.

This secondary cell wall is made up of cellulose,hemicellulose,and lignin.

They function in providing additional strength,support, rigidity to cells and the larger plant.

8 0
3 years ago
Read 2 more answers
Which is the result of an object's motion?
iren [92.7K]

Answer:

second law

Explanation:

becuz it states that force os directly proportional to the product of acceleration and mass

f=mxa

7 0
3 years ago
Other questions:
  • summerize what happens in phase 1 and 2 of photosynthesis and describe where each phase occurs in the chloroplast.
    12·1 answer
  • A firefighter wakes up in the middle of the night to the sound of an alarm. it is likely that her _____ have released epinephrin
    6·1 answer
  • Viral DNA makes mRNA by the process of _____. Viral DNA makes mRNA by the process of _____. replication infection translation ly
    7·1 answer
  • In one town, some people support a proposal to
    10·1 answer
  • An inadequate secretion of thyroid hormones results in ___________, which is characterized by weight gain and lethargy, while an
    8·1 answer
  • A slow reproduction process is a disadvantage of which form of reproduction?
    7·1 answer
  • What are the synergist muscles that help the triceps brachii???
    14·1 answer
  • What are seven characteristics that make a living thing different from non-living things
    12·1 answer
  • After a search of nucleotide sequence databases, researchers identified an IRE in the 5c untranslated region of a gene encoding
    15·1 answer
  • 1.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!