what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
1 answer:
You might be interested in
Hello Ecool, thank you for asking a question here on Brainly!
You Asked ➤ Certain species of ______ are now recognized as indicators of environmental pollution.
↴ OUR CHOICES ↴
A. Lichen
B. Mushroom
C. Yeast
D. None of the above
------------------------------------------------------------------------------------
ANSWER ➤A: Lichen
Explanation: Certain species of lichen are now recognized as indicators of environmental pollution because they have a chemical defense strategy in their habitat. Research has shown that half of lichen species will have some type of chemical that is antibiotic. Because of this, they are seen as indicates of environmental pollution.
I hope this answer is helpful to you, but please let me know if you have any other questions regarding it.
<em>- Qamar </em>
