1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]3 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
When the vasomotor center of our brain wishes to increase blood pressure, it increases ____________ signals causing ______.
dlinn [17]

When the vasomotor center of our brain wishes to increase blood pressure, it increases<u> the heart rate signals </u>causing<u> The greater contraction of the heart causes more blood vessels to constrict, increasing the blood vessels' resistance.</u>

By speeding the heartbeat, making the heart beat harder, and constricting some blood vessels, the sympathetic nervous system increases blood pressure. This will enhance the vessels' resistance.

What controls blood pressure by the vasomotor center?

The vasomotor center modifies the tone of the vascular smooth muscle. Both the local and systemic blood pressure are impacted by this. The vasomotor center produces increased sympathetic tone when blood pressure lowers. This causes an increase in blood pressure.

How is blood pressure regulated?

The autonomic nervous system has short-term control over blood pressure (ANS). Baroreceptors are capable of detecting changes in blood pressure. These are situated in the carotid sinus and aortic arch. High arterial pressure causes the blood vessel wall to stretch, activating the baroreceptors.

What systems regulate peripheral resistance in the vasomotor center?

The vasomotor center in the tunica media regulates smooth muscle contraction or vessel tone. Circulating output is impacted by changes in peripheral resistance, pressure, and flow. The majority of these neurons are in charge of causing sympathetic neurons to release the neurotransmitter norepinephrine.

to learn more click below-

brainly.com/question/10013870

#SPJ4

8 0
2 years ago
Bats have oversized ears which help the bats use sound wave to detect the motion of their prey
SIZIF [17.4K]

Answer: what are you asking in this question?

Explanation:

8 0
3 years ago
Read 2 more answers
Please help me out if u do, thank u:)
eimsori [14]
Solid i believe. hope this helps
5 0
3 years ago
Read 2 more answers
Alex had two black rats (dominant). He allowed his black rats to mate and was shocked to see that three of the rat babies were b
Anton [14]

i think it is co-dominant

8 0
3 years ago
Read 2 more answers
HELP ASAP.... will give brainliest if right
BartSMP [9]
I think the answer is A Explanation- :)
4 0
3 years ago
Read 2 more answers
Other questions:
  • I’ll give Branliest answer!
    7·1 answer
  • Based on California's experience with caulerpa the killer algae explain why it is important to regulate the pet and aquarium tra
    15·1 answer
  • Give a scenario where a cell may need to perform a form of endocytosis
    6·2 answers
  • If an rna strand has 20 adenine, how many thymine would it have?
    10·1 answer
  • If the body plan of an animal is considered bilaterally symmetrical, ? A. The anterior and posterior ends are symmetrical B. The
    5·2 answers
  • Any animal eaten by a predator could be classified as:
    10·1 answer
  • What cellular structure begins to reform during telophase?
    14·1 answer
  • 6. Transcription takes place in the ____________ of a cell. _____________________, an enzyme, binds to the DNA. It separates the
    5·1 answer
  • A pear plant with the genotype Aa can produce gametes containing:
    12·1 answer
  • Which is an example of carbon accumulating in the geosphere?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!