1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
3 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]3 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
Plants that are located inside typically have
enot [183]
Aglaonema.
Dracaena.
Ferns.
Philodendrons.
Palms.
Pothos.
Spathiphyllum.
Succulents.
4 0
3 years ago
Hormones play an important role in regulating blood glucose levels. what is an example of this?
Ber [7]
The human body wants blood glucose (blood sugar) maintained in a very narrow range. Insulin and glucagon are the hormones which make this happen. Both insulin and glucagon are secreted from the pancreas, and thus are referred to as pancreatic endocrine hormones. The picture on the left shows the intimate relationship both insulin and glucagon have to each other. Note that the pancreas serves as the central player in this scheme.  It is the production of insulin and glucagon by the pancreas which ultimately determines if a patient has diabetes, hypoglycemia, or some other sugar problem.(i hope this can help you) :)
3 0
3 years ago
1) What were the main lessons you learned about living things?
taurus [48]

StMary's a good day for me and you are the kids going ❤️❤️ a good time☺️☺️

7 0
3 years ago
Read 2 more answers
What is the name of the process shown in the picture below?
Vikentia [17]

Answer:DNA replication

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following is an example of parasitism?
SpyIntel [72]

Answer:

Female mosquitoes feed on the blood of animals

Explanation:

6 0
3 years ago
Other questions:
  • Which statement best contrast food chains and food webs​
    11·1 answer
  • Differing amounts of solar radiation across earths latitude affects the ocean ____?
    11·1 answer
  • what natural hazard is often caused by human activities and is triggered during and after periods of drought
    12·2 answers
  • When NADH is the electron donor to the respiratory chain, 2.5 ATP are formed, but when FADH2 is the electron donor, only 1.5 ATP
    10·2 answers
  • Adaptation of spermatozoon
    7·1 answer
  • Because the urchin life involves two or more ecological niches, they are more susceptible to predation and exposure to environme
    12·1 answer
  • Why is the following sentence false?
    9·1 answer
  • Why do water molecules “stick together”?
    11·1 answer
  • What would you see if you were standing in the path of totality?.
    13·2 answers
  • In one to two sentences, explain why there is more concern for severe storms in low-pressure systems.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!