1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
What would happen to an organism if its cell membranes became permeable to most substances
levacccp [35]

It would die after harmful substances entered the cell. This would happen because it would burst due to over-bulging.

4 0
3 years ago
Las células tienen cerebros que las dirige?
Nesterboy [21]

Answer:

el nucleo ... las celulas tienen un nucleo ñas cuales las dirige por asi decirlo

8 0
2 years ago
Enzymes can be denatured unfolded by what environmental factors
erastova [34]

Enzymes can be denatured unfolded by heat or chemicals.

<h3>What are enzymes?</h3>

Enzymes are proteins that are found in living organisms which are able to increase the rate of chemical reaction and remains unchanged at the end of the reaction.

The factors that can denature enzymes include heat and chemicals. This is because:

  • Higher temperatures disrupt the shape of the active site, which will reduce its activity, or prevent it from working. When the enzyme loses its shape, it is said to have been denatured.

  • These environmental factors can alter the pH level of the enzyme.

Therefore, for an enzyme to perform its functions, the external factors that affects it's activities must be normal and favorable.

Learn more about enzymes here:

brainly.com/question/19423601

#SPJ1

3 0
2 years ago
What is an analogy for chloroplast in a school?
Vaselesa [24]
Since chloroplast use energy to make food for plant cells (Photosynthesis) I could compare it to lunch money, and how you have to keep refilling up, and up, just to use it again for food, for yourself.
5 0
3 years ago
The pap smear is ________ percent approximate in detecting cervical carcinoma
Katen [24]
Pap smear (Papanicolau smear) is a procedure that involves swabbing the endocervix (inner part of the cervix), ectocervix (outer part of the cervix), and the vaginal walls. This smear will then be fixed and then viewed through a microscope to check for atypical cells (or cancer cells). Pap smear has a 95% sensitivity so pap smear can detect cervical carcinoma 95% of the time. 
5 0
3 years ago
Other questions:
  • The discovery of seafloor subduction processes gave evidence to tectonic theory because it explains how the seafloor can be expa
    12·2 answers
  • Gillian has blue eyes and brown hair. these are examples of
    10·2 answers
  • A fish living in an environment cold enough to freeze the water in its body is not an extremophile.
    13·1 answer
  • 1. Which of the following structures is most likely to be found in an autotrophic protist?
    15·2 answers
  • Why do the lungs appear collapsed in the fetus
    15·1 answer
  • An annual mustard plant survives only one month during which it produces 50 flowers. each flower produces a fruit containing 20
    15·1 answer
  • Which bases are found in a strand of dna? thymiwhich bases are found in a strand of dna?
    10·2 answers
  • Like DNA, RNA has<br> bases.
    5·1 answer
  • Which cell structure functions as a storage site for water
    12·1 answer
  • What is the main purpose of the flowers of a peach tree?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!