1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
Plzz helpp! will give brainliest!<br><br> In your own words, what is the definition of the Universe?
Basile [38]

Answer:

The Universe is the endless void of space that contains galaxies,black holes,asteroids,stars,planets and other astronomical bodies.

Explanation:

Because it's facts...

4 0
3 years ago
The difference between the meanings of combining forms spondyl/o and vertebr/o is
masha68 [24]
The difference between the meanings of combining forms spondyl/o and vertebr/o is spondyl/o and vertebr/o both mean vertebra. There is no difference because they are both vertebra.
Spondyl/o is a combining form meaning vertebrae. The two combining forms for vertebrae bones of the spine, are vertebr/o and spondyl/o.
3 0
2 years ago
What are the lipids that contribute to the structure and function of the cell membrane?
siniylev [52]

Solution:

Phospholipid lipids is that contribute to the structure and function of the cell membrane.

Lipids all have one thing in common - they do not mix well with water. You can see this quite well if you try to combine oil and water. No matter how much or how hard you shake them together, they remain separated. This can be useful for organisms. For example, ducks produce lipids in their feathers, allowing the water to roll right off their backs and helping the ducks stay afloat.

Phospholipids are made up of two fatty acids (long chains of hydrogen and carbon molecules), which are attached to a glycerol 'head.' The glycerol molecule is also attached to a phosphate group, and this is the hydrophilic part of the molecule. The 'tail' ends of the fatty acid chains opposite the glycerol is the hydrophobic part of the molecule

The most important function for a phospholipid is to form the phospholipid bilayer. In this bilayer, the phospholipids are arranged so that all the hydrophillic heads are pointing outward and the hydrophobic tails are pointing inward. This arrangement comes about because the areas both outside and inside your cell are mostly water, so the hydrophobic tails are forced in.

THis is the required answer.

7 0
3 years ago
Rest intervals between sets for hypertrophy training when using 70%-80% of 1rm should be _____ to optimize the anabolic hormone
telo118 [61]
The answer that best completes the statement above is 30-60 seconds. This is the rest interval needed in between sets for hypertrophy training. The purpose of this rest interval is to optimize the anabolic hormone response. So basically, this hypertrophy training aims in growing the muscles faster with great efficacy. 
4 0
3 years ago
Which event does not need to take place before meiosis can begin
marta [7]

DNA Replication maybe?

8 0
3 years ago
Other questions:
  • What are some ways that a cat and a tree are similiar?​
    5·2 answers
  • What is a benefit of using nonrenewable resources? (2 points)
    7·1 answer
  • What combination of processes can transform a metamorphic rock to sediments? a. erosion, crystallization, and melting b. heating
    9·1 answer
  • What differentiates the isotopes of an element?
    8·1 answer
  • if pea plants that are homozygous for round, yellow seeds (RRYY) were crossed with pea plants that are heterozygous for round, y
    10·1 answer
  • One reason the skeletal system is important is because __________. A. without the skeletal system, an individual would not have
    5·2 answers
  • I will mark you as brainlinest for correct answer!!!!!pleaseeeee help!!!!!!
    5·1 answer
  • I need the answer please
    6·2 answers
  • In a certain plant yellow leaves are dominant and red leaves are recessive. apex
    11·1 answer
  • Repeating a scientific experiment and reproducing the same results is<br> referred to as what?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!