1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
4 points
Hatshy [7]

Answer:

it is might be wrong....

Explanation:

Third-trimester ultrasounds can examine the placenta and the position of the fetus. Sometimes an ultrasound is part of a test called a biophysical profile (BPP) to see whether the fetus is getting enough oxygen. The BPP examines the baby's breathing, movement, amount of amniotic fluid, tone, and heart rate response.

7 0
3 years ago
Read 2 more answers
What is the smallest part in your body
Aleks [24]
What’s the smallest muscle in the human body? The stapedius, in your middle ear, measures about 1mm in size (or 1/26 of an inch). Connected to the stapes bone, it contracts to pull back the stapes and help protect your inner ear from loud noises. The stapedius also contracts to keep your own voice from sounding too loud in your head.
What’s the smallest bone in the human body?
Conveniently, that would be the stapes. It is one of three tiny bones in the middle ear that convey sound from the outer ear to the inner ear. Collectively called the ossicles, these bones are individually known as the malleus, incus, and stapes. Those are Latin words for the shapes the bones resemble: a hammer, anvil, and stirrup.
What’s the smallest organ in the human body?
You’ll find the pineal gland near the center of the brain, in a groove between the hemispheres. It’s not an organ like those in the abdominal cavity. It’s the human body’s smallest endocrine gland, and it produces melatonin, a hormone (derived from serotonin) that affects how we sleep, wake up, and react to seasonal changes. It’s called pineal because it’s shaped like a little pinecone.
What’s the smallest blood vessel in the human body? <span>Capillaries, the smallest, thinnest-walled blood vessels in the body, connect veins and arteries. They can be as small as 5-10 micrometers wide — or 50 times thinner than a baby’s hair. Each of us contains about 10 billion of them, with the average adult body containing about 25,000 miles of capillaries.</span>
4 0
3 years ago
Read 2 more answers
Which structures are part of the appendicular skeleton?
kompoz [17]
It is the rib cage (thoracic cage)
8 0
3 years ago
Read 2 more answers
Nevermindi got the answer
Sergeeva-Olga [200]

Answer:

ok

Explanation:

8 0
3 years ago
Read 2 more answers
If the moon is setting at midnight, what phase is it?
joja [24]

Answer:

the the climax of the night

8 0
3 years ago
Other questions:
  • The graph shows the average monthly rainfall for a forested area.
    11·2 answers
  • Which type of instrument uses an objective lens and an eyepiece lens? a. microscope c. camera b. reflecting telescope d. eyeglas
    9·1 answer
  • What is the difference between a monosaccharide and a disaccharide?
    13·1 answer
  • In a organism, the brain directs the body how to respond to stimuli from the environment. in a cell, this function is performed
    7·1 answer
  • Fragments of volcanic rock and ash that build up to form cinder cones are known as
    8·1 answer
  • The acronym vdl stands for variation dependent leadership. <br> a. True <br> b. False
    8·1 answer
  • Once the body has begun shivering, what happens to make it stop shivering?
    10·2 answers
  • What type of bird is this
    10·1 answer
  • True or false: atoms can only form bonds by transferring or stealing valence electrons from each other.
    15·1 answer
  • What occurs when mitosis keeps dividing?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!