1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mariarad [96]
2 years ago
5

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC

CACAACT and TACCTGTTAAGCTACAAAATT?
Biology
1 answer:
VLD [36.1K]2 years ago
7 0

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

You might be interested in
_____ recognized the vital role of the internal environment and suggested that the objective of mechanisms within the body is to
VikaD [51]
Carolus Linnaeus recognized the vital role of the internal environment and suggested that objective of mechanisms within the body is to preserve the constant conditions of the internal environment.
He was later known as the creator of current modern system of naming animals called binomial nomenclature 

hope this helps
5 0
3 years ago
The creation of an artificial opening into the bladder is called a(n) ______stomy
tatyana61 [14]
It is a urostomy :)))

4 0
3 years ago
Abnormal cells crowd out cells and steal nutrients.
elena-14-01-66 [18.8K]
<span>The statement "Abnormal cells crowd out cells and steal nutrients" is true. Abnormal cells are the cells that are not considered as normal and usual in the human body. Cancer cells are example for abnormal cells. These </span><span><span>ignore normal laws of tissue boundaries and local territories. They cause problems to cells and organs crowd out other organs, take up space and prevent other critical functions from happening.</span> </span>
7 0
3 years ago
The medullary cavity is Select one: a. empty in adult bones. b. the site where osteoblasts are found. c. lined with endosteum. d
katrin [286]

Answer:

C- Lined with Endosteum

Explanation:

The medullary cavity, also called the marrow cavity, stores red and yellow bone marrow (or adipose tissue). It is the central cavity in the shaft of bones.

Endosteum lines the inner surface of the medullary cavity. It is a thin, vascular membrane of connective tissue with the purpose of being absorbed when a person is malnourished.

6 0
3 years ago
What hormone released into the blood (shown by letter
Natasha_Volkova [10]
<span>antidiuretic hormone (ADH)</span>
4 0
3 years ago
Other questions:
  • A lizard lives in a desert. Which would be an adapation for this lizard?​
    9·1 answer
  • Energy stored in the bonds that hold together the atoms and molecules of all substances is called what
    6·1 answer
  • How is genetic information encoded in a dna molecule?
    9·1 answer
  • Select all the kingdoms that are composed of eukaryotes.
    9·1 answer
  • 24 Notocords is restricted to tregon<br>a) Hemichordates<br>c) Cephalochordates<br>d)ALL Chordates​
    8·1 answer
  • The brain volumes ​(cm cubed​) of 20 brains have a mean of 1116.2 cm cubed and a standard deviation of 127.7 cm cubed. Use the g
    14·1 answer
  • A.) Give one example of how animals respond to their environment
    15·2 answers
  • "How is it possible that siblings with the same parents can have such different traits, such as skin tone?"
    6·1 answer
  • What are the precautions that should be token when using a photometer? please help me​
    5·1 answer
  • Which of these is true for a daughter cell produced by mitosis?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!