Answer:
Huh!!!Where is the question???..?
I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.
<span> ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA
</span>
mRNA
UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU
he answer is because <span>samples of air taken over erupting volcanoes shows that volcanoes
contribute a small amount of chlorine in the stratosphere compared to CFCs. Volcanic
eruptions account for a large instability of chlorine from land to the
atmosphere on a yearly basis. This is in addition to chlorine that enters the
atmosphere from sea spray, industrial processes and biological gases which are
from CFCs. All of these inputs happen near or at the base of the atmosphere. Very
little of the material emitted from volcanoes makes it up into the upper
reaches of our atmosphere which is the stratosphere where it could touch the
ozone layer. However, most of it is believed to be deposited lower down which
is in the troposphere, where it then rained out back to the surface of the
earth.</span>
In single celled organisms, the cell grows larger and then divides, CREATING A NEW ORGANISM. In organisms composed of many cells, the organism GROWS BIGGER when it creates more cells.
The words I capitalized are the direct answers.
I'm sorry I got to your question so late. I hope that this helps!