1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
defon
2 years ago
13

Shelby is a plant breeder who is trying to identify the cause of a disease among a group of trees. She observes that the organis

m reproduces through spores and has reproductive structures that are shaped like a sac. Which type of fungus is it? Ascomycota Basidiomycota Chytridiomycota Zygomycota
Biology
2 answers:
Darina [25.2K]2 years ago
4 0

Answer:

Ascomycota

Explanation:

The phylum Ascomycota is the largest phylum in the Kingdom Fungi. Examples are Yeast, <em>Aspergillus, Neurospora,</em> Members of Ascomycota are called ‘sac fungi’ due to the formation of an ascus, a sac-like structure that contains haploid ascospores. During sexual reproduction, thousands of asci (singular; ascus) are formed in a fruiting body called the ascocarp. The diploid nucleus gives rise to haploid nuclei by meiosis. The ascospores are formed in each ascus after meiosis. On maturity, ascospores are released in the new environment and germinate to form hyphae and start new mycelia.  

Marina86 [1]2 years ago
3 0

Answer:

Ascomycota

Explanation:

You might be interested in
Over lunch, Rebekah chats with you about a guy to whom she is very attracted. Based on research examining interpersonal attracti
Kruka [31]

Answer:

Her friend

Explanation:

Rebekah is attracted to her friend to whom she is talking about that guy over the lunch. When a person is attracted to someone, he starts sharing his personal situations of life. When a person open up about his personal in front of someone it means he is attracted to that person and feels confidence in telling him. Rebekah is also in the same situation where she feels she is attracted to that guy but actually she is attracted to her friend with whom she is having chat about that guy.

7 0
2 years ago
Why would this procedure fail to produce a projaryotic cell
slamgirl [31]

Answer:

Explanation:because of trying to produce a damage cell

8 0
2 years ago
Multicellular organisms, life begins as a single cell until ___________ occurs, causing growth.
Nady [450]
Fertilization  which unites the sperm and egg.
5 0
3 years ago
Which best describes how the government influences scientific research
Sedaia [141]

A. The government provides funding for many scientists <span>

Research enables and promotes the scientific community at a larger scale. Contributing and collaborating knowledge all-over the people and persons in science. </span>Researches play a big role in everyone’s academic identity because 
1.       It actively makes the individual scientific in approach to things of curiosity and makes him/her use the knowledge to study and produce results which <span>
2.       The scientific society will benefit by this particular study and can work together to better explore and discover.   </span><span> </span>
6 0
2 years ago
Why is a lake with a clay bottom able to hold more water than a lake with a sand bottom​
DochEvi [55]

Answer:

Clay is the least porous of all soil types. It is the opposite of porous in comparison to sand.

7 0
3 years ago
Other questions:
  • How long can a praying mantis live without its head?
    12·1 answer
  • How could a addation or deletion of a base (A,T,C,G) in a sequence of DNA effect protein production
    13·2 answers
  • 2. What is the weight of the same book on Mars where the force of gravity is 3.7 N/kg?
    6·1 answer
  • Which division has a single preganglionic neurons with many axon collaterals that forms 20 or more synapses with postganglionic
    14·1 answer
  • What is the energy source for almost all life on earth
    8·2 answers
  • Which statement below BEST describes what biodiversity is?
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Briefly describe the life, successes, and failures of Emperor Justinian.
    11·1 answer
  • Which of the following is NOT a characteristic of life? Also, explain why and I give you a 5 stars.
    14·1 answer
  • The organization of similar organisms into groups helps scientists understand how living things are related. It
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!