1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yakvenalex [24]
3 years ago
12

Plant cells have a large central vacuole, which animal cells lack. What function does this organelle perform?

Biology
2 answers:
valentina_108 [34]3 years ago
8 0
Hey i just had a test with this question

im really SURE IT IS ----B-----



uranmaximum [27]3 years ago
8 0
The answer is B. Vacuole functions to maintain proper pressure within the plant cells to provide structure and support for the growing plant
You might be interested in
How can carbon form strong structures like cellulose (wood) and diamonds?
scoundrel [369]
Wood will break down into peat,  then will be compressed underground to make coal. Adding more compression will make diamonds.
6 0
4 years ago
HELPPP M3 IN THIS QUESTION PLEASE!!:((<br><br><br>add brainly?<br>and follow u​
Mazyrski [523]
Ya I think it’s the 4th to
4 0
4 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What are two main purposes for using repetition when conducting experiments?
antoniya [11.8K]
  1. reducing mistakes and increasing confidence in results
8 0
4 years ago
Read 2 more answers
The same dose is used for endotracheal and intravenous administration of epinephrine.
Svetlanka [38]

Answer:

False.

Explanation:

The dose for endotracheal administration of epinephrine is higher than the dose of intravenous epinephrine. The endotracheal recommended dose is 0.5 to 1.0 ml/kg of epinephrine, while for the intravenous, the recommended dose of epinephrine is  0.1 to 0.3 ml/kg.

7 0
4 years ago
Other questions:
  • For water to travel across the cell membrane at a substantial rate, the water molecules travel through protein channels
    11·1 answer
  • Lysozyme, an enzyme found in human saliva, tears, and other secretions, catalyzes the hydrolysis of the β-1,4-glycosidic linkag
    7·1 answer
  • Which is a type of irradiation used to prevent food-borne illnesses?
    6·1 answer
  • Which process of DNA replication is necessary before a cell?
    15·1 answer
  • Select two risk factors for self-harming behavior. A. Having high self-esteem B. Having a history of neglect or sexual or physic
    14·2 answers
  • What is difference between the male and female voice​
    6·1 answer
  • Why is it important to review basic chemistry at the beginning of a biology course? Give me an example of something you learned
    8·1 answer
  • When do sexually reproducing organisms do meiosis?
    5·1 answer
  • AYUDAAA
    6·1 answer
  • Pls help
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!