Explanation:
<u>B) There is an abundance of seeds and nuts.</u>
The finches have developed adaptations to their environment. Their specialized beaks allow them to adequately exploit the available resources, by utilizing the more abundant food source.
Further Explanation:
All the genetic information within the eukaryotic cell is stored within the nucleus as helical DNA. This DNA is tightly wound around histones as chromosomes. To produce daughter cells during cell division, the chromosomes (total number of chromosomes (2n)) are copied before the cell splits into two daughter cells. This process is known as mitosis, and occurs in cell division and growth processes. Two new nuclei are formed, along with identical cells. These are the same as the parent cell and the chromosome number (2n) is maintained.
Conversely in meiosis, the number of chromosomes (2n) is halved through meiotic divisions, producing 4 (n) germ cells (sperm or eggs), each containing half the number of chromosomes as its parent cell. Crossing over, independent assortment, and random fertilization ensure genetic variation.
This variation refers to the genetic characteristics present within a species; they form new traits called alleles, which may confer adaptations that increase the fitness of a species, along with ensuring survival by conferring an advantage.
Learn more about mitosis at brainly.com/question/4303192
Learn more about transcription at brainly.com/question/11339456
Learn more about DNA and RNA at brainly.com/question/2416343?source=aid8411316
#LearnWithBrainly
Answer: Prokaryotes, archaea, protists, fungi, algae.
Explanation:I don’t think there are any single celled organisms that are today classified as animals. So basically I just left the animal kingdom out. Both metazoans and sponges are for the most part multicellular.
The velocity (speed) of a sound wave (any wave in fact) is related to its frequency and wavelength by the equation . This is easy to remember since it's a distance divided by a time because frequency is the inverse of the period.
Since for sound traveling through the given solid object we have that and , the speed of sound will be:
this is what i looked up and got
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
<h3><u>Answer;</u></h3>
Golgi apparatus or Golgi complex or Golgi bodies
<h3><u>Explanation;</u></h3>
- <u><em>Golgi apparatus are also called Golgi bodies or Golgi complex. They are complex vesicles and folded membrane within the cytoplasm of eukaryotic cells.</em></u>
- <em><u>Golgi apparatus are important in the secretion and intracellular transport roles. A major function is the modifying, sorting and packaging of proteins for secretion. T</u></em><em><u>hey are also involved in the transport of lipids around the cell, and the creation of lysosomes.</u></em>
- Therefore, <u><em>Golgi apparatus are the organelles responsible for the formation of lysosomes, which are organelles that destroy old and worn out cellular organelles. </em></u>
