1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vesna_86 [32]
3 years ago
5

What does it mean when scientists say that living organisms share a universal genetic code?

Biology
1 answer:
Drupady [299]3 years ago
6 0
When scientists say they share a universal genetic code it means that all organisms it can mean either:
 -DNA as the main source of hereditary information in all life forms we know of
 or more likely
 -that all organisms we know of use a three base pair code for the synthesis of proteins, DNA produces mRNA this mRNA is read three base pairs at a time by a ribosome, this is called the genetic code.
You might be interested in
What are two reasons why terrestrial plants formed closer to the sun after the supernova event that initiated the formation of t
jasenka [17]

Answer:

- They are made of denser objects, which can condense at relatively high temperatures;

- They are made of heavier elements, which have a stronger gravitational attraction to the Sun;

6 0
3 years ago
Ozone in the troposphere is necessary to protect Earth's surface from harmful UV radiation.
romanna [79]

Answer:

False

Explanation:

In the troposphere, near the Earth's surface, human activities lead to ozone concentrations several times higher than the natural background level. Too much of this ground-level ozone is 'bad' as it is harmful to breathe and also damages vegetation.

The stratosphere or “good” ozone layer extends upward from about 6 to 30 miles and protects life on Earth from the sun's harmful ultraviolet (UV) rays.

7 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Match the following. 1. the basic building block of all forms of life resolving power 2. the idea of Schleiden and Schwann that
Roman55 [17]

Answer:

1. Cell

2. cell theory

3. Organismal theory

4. resolving power

Explanation:

The cell is the smallest known unit of all living organisms. They are called the building blocks of life. An organism can be unicellular (made up of one cell) or multi-cellular (made up of many cells).

2. Cell theory was formulated and developed  by Schleiden, Schwann, and Virchow. They are considered as the basic principles of biology.

It states:

1. Living organisms are made up of cells.

2. Cells are the basic unit of life.

3. Cells are formed from pre-existing cells.

4. Energy flows inside the cell.

5. DNA is passed on from cell to cell.

6. All cells have the same basic chemical composition.

3. Organismal theory is the intended counter-argument of the cell theory. It was developed by Reichert, Strasberger, Sherrington, and Pavlov. It argues that the basic unit of life is the organism itself, suggesting that an organism came about from a cell that expanded.

4. Resolving power is the ability of an optical instrument like a microscope or a telescope to view objects that are close together as separate, abling the viewer to distinguish the two from each other.

5 0
2 years ago
Horizontal gene transfer can occur through several mechanisms. Why is this relevant to humans?
Fiesta28 [93]

Answer:

B. Bacteria can exchange genes for resistance to antibiotics in this way.

Explanation:

Even though conjugation requires cell-to-cell contact, it can occur between distantly related bacteria

7 0
2 years ago
Other questions:
  • How many different arrangement of four bases into triplets can be made
    8·1 answer
  • Please let me know as soon as possible
    7·1 answer
  • Do Genes make up chromosomes.
    6·2 answers
  • Please help guys! Points + Brainliest
    13·2 answers
  • Which describes a population depending on an abiotic factor?
    7·1 answer
  • Which answer places the following events in proper order for pulmonary ventilation?
    11·1 answer
  • Plant and animal cells differ in a variety of ways. Plants have a special structure that helps them produce their own food. With
    9·2 answers
  • How is ADP converted to ATP?
    8·1 answer
  • A scientist is conducting research about all the plants and wildlife in the Mojave Desert as well as the desert’s resources, suc
    9·1 answer
  • HELP ME WITH THIS PLEASEE
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!