1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr [31]
3 years ago
8

BRAINLIESTTTT ASAP!!

Biology
1 answer:
cestrela7 [59]3 years ago
6 0

I am not sure about the second one, but I know the first one.

The answer is D.

"An irregular galaxy is a galaxy that does not have a distinct regular shape, unlike a spiral or an elliptical galaxy. Irregular galaxies do not fall into any of the regular classes of the Hubble sequence, and they are often chaotic in appearance, with neither a nuclear bulge nor any trace of spiral arm structure."

You might be interested in
The primary sources of renewable energy in the united states are:.
Fofino [41]
Solar energy from the sun.

Geothermal energy from heat inside the earth.

Wind energy.

Biomass from plants.

Hydropower from flowing water.
4 0
2 years ago
Help!
andrezito [222]

Answer:

None of the above

Explanation:

6 0
4 years ago
Which are examples of steroids
Alchen [17]

Answer:

Glucocorticoids: alclometasone, prednisone, dexamethasone, triamcinolone

Mineralocorticoid: fludrocortisone

Vitamin D: dihydrotachysterol

Androgens: apoptone, oxandrolone, oxabolone, testosterone, nandrolone (also known as anabolic steroids)

Oestrogens: diethylstilbestrol (DES)

Progestins: danazol, norethindrone, medroxyprogesterone acetate, 17-Hydroxyprogesterone caproate.

Explanation:

These are all synthetic steroid hormones.

3 0
3 years ago
Do white blood cells live longer than red blood cells?.
Morgarella [4.7K]

Answer:

Red blood cells live about 120 days, and platelets live about 6 days. Some white blood cells live less than a day, but others live much longer.

Explanation:

7 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Other questions:
  • A client reports having three episodes of fever that have lasted several days, with periods of normal temperature in between the
    14·1 answer
  • Which of the following would be entirely of nonrenewable sources ?
    9·1 answer
  • Help f f f f f f ffff f f f
    5·2 answers
  • What are actions or behaviors that may have (or may not have) taken place before someone dies?
    10·1 answer
  • Which type of traits vary quantitatively due to the interaction of multiple genes? polygenic codominant incomplete dominant domi
    15·2 answers
  • Can someone please help me . Science ~
    12·2 answers
  • A 2. Which of the following are features that help scientists classify annelids into their respective classes? O presence of set
    14·1 answer
  • Please help i’m on a timer
    6·1 answer
  • The ___________________ contains receptors for monitoring the position of the head.
    5·2 answers
  • The bacterium Staphylococcus aureus belongs to which domain?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!