1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
3 years ago
8

Match each environmental factor that affects plant and animal life in aquatic biomes to its description/purpose.

Biology
2 answers:
lana66690 [7]3 years ago
7 0

Answer:

Explanation:

Salinity- This term refers to the salt content of water.

Salinity can be define as the total salt concentration present in water or any other liquid. It is the environmental factor which fluctuates in the oceanic water. Some of the organisms can tolerate the high salinity levels others are not adapted.

Water flow conditions- Different plants and animals need different conditions to survive. Some prefer flowing streams, and some need shallow water.

The water flow conditions can be determined by the speed of water and it's density. These conditions influence the lives of living beings such as plants and animals.

Water depth- When this factor increases, the amount of sunlight that reaches plants and animals under water decreases.

The water depth can vary among different layers and zones of the water body or aquatic biomes. The deepest zone or layers generally do not receive sunlight as the rays of sunlight are incapable of penetrating the deep water layers.

Dissolved oxygen- Life forms in aquatic biomes need this to survive.

The oxygen is the necessary element that is required for the respiration which is the vital function required for living in both terrestrial and aquatic biomes. In the water, the oxygen get dissolved from the atmosphere.

VladimirAG [237]3 years ago
5 0
Salinity- This term refers to the salt content of water.

Water flow conditions- Different plants and animals need different conditions to survive. Some prefer flowing streams, and some need shallow water.

Water depth- When this factor increases, the amount of sunlight that reaches plants and animals under water decreases.

Dissolved oxygen- Life forms in aquatic biomes need this to survive.
You might be interested in
Psychoactive substances that are depressants include ______.
Sergeeva-Olga [200]
The blank is going to represent marijuana, LSD,PCP, and ecstasy. sited by google. hope that helped
5 0
3 years ago
Explain how the melting of the sea ice may affect<br><br> people living on the coast of Florida.
Levart [38]

Since 2000, melting ice from the continent totaled enough to raise sea levels globally by about four tenths of an inch, according to the report which relied on the work of 90 scientists.  With what’s already baked into the atmosphere, faster melting land ice will likely add between 7.5 and 9.8 inches to earlier U.N. estimates by 2100, the report said.  And because of its position downstream, in an area of “preferential excitement,” South Florida could experience rise at the high end as water sloshes around the planet, Kirtman said.  “Think of it as pushing down the ocean [in Greenland]. The ocean is fluid, so it’s going to respond somewhere else and that somewhere else is down here,” he said.  In South Florida, planners already confronting flooding from sea rise have been more aggressive in assessing sea rise.

Explanation:

3 0
3 years ago
Which event occurs FIRST in an astronaut’s day?
eimsori [14]
The first event or first thing they do, because the first thing they do is exercise for 2 hours everyday to keep their muscle and bone strength.
4 0
3 years ago
Read 2 more answers
WHAT IS THE cell membrane gateway system is specifically called the
jek_recluse [69]
The cell membrane gateway system you are looking for is called <span>Sodium Potassium Pump.</span>
6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Which group of living things can move energy from consumers at the top of an energy pyramid back to producers at the bottom? *
    6·2 answers
  • The bacteria lactobacillus acidophilus is used as a probiotic therapy for gastro intestinal upset. why would a doctor deliberate
    10·1 answer
  • How are the monsoons both beneficial and destructive?
    5·1 answer
  • What three particles make up atoms?
    14·2 answers
  • Describe the 3 main types of forest lands
    10·1 answer
  • As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? a. The polypeptide enters the E s
    11·1 answer
  • Which factor contributes to both chemical and mechanical weathering? abrasion freezing oxidation​
    5·2 answers
  • What’s the answer for these help?
    15·1 answer
  • HELP PLEASEEEE ASAP.
    8·1 answer
  • What is the importance of adaptation as a mechanism for the survival of species?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!