1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
9

the phenotype frequency in a population changes after each generation . which would most likely cause this?

Biology
1 answer:
Gnesinka [82]3 years ago
6 0

Answer:

Organisms compete for shelter  

Explanation:

Just took the test and answered this

You might be interested in
What is the definition of cellular respiration? ​
Eduardwww [97]

Answer:

it is a biochemical process that involves the oxidization of glucose to release energy with the formation of carbon dioxide and water as by products

Explanation:

4 0
2 years ago
The difference between the meanings of combining forms spondyl/o and vertebr/o is
masha68 [24]
The difference between the meanings of combining forms spondyl/o and vertebr/o is spondyl/o and vertebr/o both mean vertebra. There is no difference because they are both vertebra.
Spondyl/o is a combining form meaning vertebrae. The two combining forms for vertebrae bones of the spine, are vertebr/o and spondyl/o.
3 0
3 years ago
Nitrogen and sulfur oxides always have been produced in nature by ____ and wildfires
rjkz [21]

Answer:

mixtures and fire

Explanation:

N2+ So4- N(so4)2

6 0
3 years ago
Which statement describes potassium-argon dating?
Fiesta28 [93]

Answer: Potassium-40 decays into argon gas over time.

Explanation: Potassium-argon dating is a dating method used to determine the age of sedimentary rocks by comparing the proportion of K-40 to Ar-40 in a sample of rock, and knowing the decay rate of K-40.

Potassium-40 undergoes decay following first order kinetics as given below:

_{19}^{40}\textrm{K}\rightarrow _{18}^{40}\textrm{Ar}+_{0}^1e

3 0
3 years ago
Read 2 more answers
In which type of environment might water soluble rocks such as limestone or dolostone become ridge formers?
Sergeeva-Olga [200]
I would say that the most likely environment for these two rock types to be ridge formers would be an arid climate like a desert where there was little water to dissolve. Also, even in a normal temperate environment, dolomite can form a very resistant ridge or cliff former as is the case with the Palliser Formation in Banff Park which forms a pronounced cliff which is very extensive.
8 0
3 years ago
Other questions:
  • Which best characterizes the Precambrian era?
    9·2 answers
  • !*!*!*!**!* ANSWER QUICK *!**!*!*!*!
    10·1 answer
  • What is an a abiotic organism?
    10·1 answer
  • Why is the top layer of the ocean the warmest?
    8·2 answers
  • You want to know if feeding rabbits corn is better for their growth than the normalfed pellets that they eat. You have 20 rabbit
    11·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The manubrium articulates with the ________ on its superior border.
    11·1 answer
  • Hey guys i need some good facts about mars and pluto and fast will give brailiest and five stars
    11·1 answer
  • How do sprouting plants exhibit positive gravitropism? A. The roots turn downward. B. The roots move horizontally. C. The leaves
    14·2 answers
  • Most populations do not experience: ____ va) exponential growth b) Linear growth c) Resources d) Competition
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!