1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ainat [17]
3 years ago
10

What body parts are involved in thermoregulation

Biology
2 answers:
zysi [14]3 years ago
7 0

Thermoregulation is mostly used in deep organs like the liver, heart, brain, and in the contractions of the skeletal muscles.

IgorC [24]3 years ago
4 0

As in other mammals, thermoregulation in humans is an important aspect of homeostasis. In thermoregulation, body heat is generated mostly in the deep organs, especially the liver, brain, and heart, and in contraction of skeletal muscles.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The ability of the human body to break down the red color in beets is controlled by an autosomal dominant allele. The inability
Zinaida [17]

Answer:

Explanation:

<em>Let the ability to break down the red color in beets be represented by the allele </em><em>B</em><em>. The inability would be represented by the allele </em><em>b</em><em>.</em>

A nonsecretor's genotype would be BB or Bb while a secretor's genotype would be bb.

A nonsecretor woman with a secretor father would be a carrier with genotype Bb. A nonsecretor man who in a previous marriage had a secretor daughter would also be a carrier with genotype Bb. If the two marries:

            <em>Bb     x     Bb</em>

<em>            BB    2Bb    bb</em>

1.

(a) probability of their first child will be a secretor girl = probability of having a girl and being a secretor.

Probability of having a girl = 1/2

Probability of being a secretor = 1/4

<em>probability of their first child will be a secretor girl</em> = 1/2 x 1/4 = 1/8

(b) Probability of their first child being a nonsecretor girl = probability of having a girl and being a nonsecretor.

Probability of having a girl = 1/2

Probability of being a nonsecretor = 3/4

<em>Probability of their first child being a nonsecretor girl = probability of having a girl and being a nonsecretor</em> = 1/2 x 3/4 = 3/8

2. <em>Probability that their first two children will be nonsecretors of either sex = probability of their first being a nonsecretor and of either sex and probability of their second being a nonsecretor and of either sex.</em>

  = 3/4 x 3/4 = 9/16

6 0
4 years ago
Bone formation begins when ____________ secrete the initial semisolid organic form of bone matrix called ____________ .
butalik [34]

Answer:

a. osteoblasts

b. osteoid

Explanation:

Osteoblasts are the fundamental cell of bone tissue. They are the cells that synthesize the bone matrix called osteoid from which it is made from the skeleton of bone fish, to the skeleton of humans. Since the bone skeleton is an evolutionary paraphiletic characteristic (it is present in several taxonomic groups that have evolved from the same ancestor).

Osteoblasts are responsible for the development and growth of bones during the juvenile stage of individuals and are also responsible for maintaining adult bone and regenerating bone when it breaks.

Osteogenesis is the process of differentiation of osteoblasts. The cells from which osteoblasts differ are called osteoprogenitors. The differentiation of osteoprogenitor cells, which come from the mesoderm, periosteum or bone marrow, is induced by growth factors called bone morphogenetic proteins (BMPs), capable of inducing the growth of bone, cartilage or connective tissue. When an osteoprogenitor cell receives a BMP signal, it quickly begins to express the genes to generate collagen, osteonectin and alkaline phosphatase, among other compounds necessary for bone growth. When the bone grows, it ends up wrapping some of the osteoblasts and they lose their ability to replicate, at that time they are dedicated to bone maintenance and not to their synthesis and are called osteocytes.

6 0
3 years ago
1. A mutation of a human gene blocks harmful viruses from infecting cells. How can the mutation be classified?
Yuri [45]

Answer:

It is a beneficial mutation.

Explanation: Mutations are permanent changes in the nucleotide sequence of a DNA. Mutations can beneficial, neutral and harmful or deleterious. When change in the nucleotide sequence of DNA a mutation enhances the effectiveness of a protein or improves the protein function, it is said to be beneficial. When a mutation causes the synthesis of a protein which have the same amino acid as the original protein and performs the same function as the original protein, it is said to be silent or neutral. When a mutation results in the synthesis of a protein with an altered amino acid sequence and a nonfunctional protein, it is said to be harmful.

3 0
3 years ago
1 pts<br> Which will most likely cause variations to occur within a species?
swat32

Answer:

1 pt ty so much

and u need to give us the rest of the question

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which energy transformation takes place when a match is struck against the side of a matchbox and burst into flames?
    12·2 answers
  • Antibiotics are prescribed for a child with otitis media who underwent a myringotomy with insertion of tympanostomy tubes. The n
    7·1 answer
  • Osmosis is the diffusion of small molecules. -------------------------------------------------------------------------------- Tr
    11·1 answer
  • How long can a human live without food
    14·2 answers
  • How long is the world
    11·1 answer
  • It took Jeremy two hours to hike to the top of the mountain. Two weeks
    14·1 answer
  • 1. What is the study of the cosmos? The study of the cosmos includes what topics?
    12·2 answers
  • WILL BARK BRAINLIEST. LOTS OF POINTS
    15·2 answers
  • What is produced by the lymph system?
    15·2 answers
  • A researcher studied the development of resistance to antibiotics by bacteria. She studied several antibiotics to determine how
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!