Mother. red-green color blindedness is maternally inherited
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
1.) Kinetic energy decreases
2.) The attraction increases
3.) Space between the particles decrease
Explanation:
That's what I think it is.
Answer:
D. all of the above.
Explanation:
In the carbon cycle, carbon is found in the atmosphere, the soil, and living organisms.
<em>The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again. Most carbon is stored in </em><em>rocks and sediments</em><em>, while the rest is stored in the ocean, </em><em>atmosphere</em><em>, and </em><em>living organisms.</em>
The deeper you go down in to the rock the older the fossils get. So when the scientists go in to the rock they can say what animals lived in that time and what animal was the oldest.