1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
1 year ago
13

Which sequence of processes transports water from the atmosphere to the ocean and then back into a cloud?

Biology
1 answer:
Airida [17]1 year ago
3 0
Answer: Precipitation -> evaporation -> condensation

Explanation: precipitation is when it rains, so water is delivered by the atmosphere into the ocean. Evaporation happens when water in the ocean is heated up and returned to the atmosphere. Condensation occurs when water condenses due to pressure/temp differences creating clouds.
You might be interested in
The _____ on a map will help determine the direction of a location in relation to another location. legend compass scale color-c
Reika [66]
Compass is the answer
4 0
3 years ago
Read 2 more answers
True or false<br><br> - our phenotype is solely determined by genotype.<br><br> plz help:)
Shtirlitz [24]

Answer:

true, i think! im sorry if im wrong

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
What material let's light pass through freely
Airida [17]
Transparent materials allow light to pass through freely. translucent lets light pass through, but after the light is scattered. 
4 0
3 years ago
Read 2 more answers
What is Osmosis.. Please define it and give some examples.​
Triss [41]

Answer:

Explanation:

osmosis is the movement of water molecules from the region of higher concentration to the region of lower concentration down the concentration gradient.

some of the examples are root hair cells as they absorb water molecules from the soil and are low in concentration compare to the soil. so osmosis takes place

3 0
1 year ago
Other questions:
  • A 2200kg suv hits a wall and goes from 26 m/s to 0 m/s in 0.2 seconds how much force did the driver experience
    11·1 answer
  • Chris, who works at a pesticide factory, comes to the clinic complaining of muscle spasms that interfere with his movement and b
    14·1 answer
  • Can someone explain anticondons?
    14·2 answers
  • 5.
    15·1 answer
  • You spill a small amount of a chemical (an acid)
    7·2 answers
  • Which of the following best describes the circuit shown below?
    10·2 answers
  • If a government entity wanted to write regulations that might reduce smog, what human activities might they want to focus on?
    12·1 answer
  • Now, this time observe what happen if the box where pushed toward each other
    12·1 answer
  • Cuales es el concepto de habitos
    11·1 answer
  • You carry out a self-cross of the offspring produced from a cross between homozygous pea plants with yellow and green seeds. You
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!