The causative agents for gas gangrene and tetanus are:

Biology

1 answer:

jonny [76]3 years ago

4 0

Answer:

Obligate anaerobes (Ans. D)

Explanation:

Gas gangrene is a bacterial infection which produces tissue gas in gangrene. This is caused by bacteria Clostridium perfringens. Clostridium perfringens is a gram-positive, obligate anaerobic bacterium of the Clostridium genus. It is found in environmental sources & commonly found in raw meat and poultry.

Tetanus is a bacterial disease infected by Clostridium tetani, is an obligate anaerobic spore-forming bacteria. It is found in soil, dust and intestinal tracts of animals. Transmission of tetanus is commonly by contaminated wounds.

You might be interested in

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

Are particles located within an atom's nucleus.

Naddik [55]

Electrons are the smallest of the three particles that make up atoms. Electrons are found in shells or orbitals that surround the nucleus of an atom. Protons and neutrons are found in the nucleus. They group together in the center of the atom.

3 0

2 years ago

Select the correct regional term based on the common body terms below.

Akimi4 [234]

hopefully this helps, these are the answers on edge

5 0

2 years ago

Help fast for brainliest please please

Schach [20]

Answer:a u have both ur parents genes Dd and Dd

Explanation:

7 0

2 years ago

Explain how genetic mutations are introduced into a population of organisms.

vova2212 [387]

Answer:

The flow of individuals in and out of a population introduces new alleles and increases genetic variation within that population. Mutations are changes to an organism's DNA that create diversity within a population by introducing new alleles.

I hope it's helpful!

8 0

2 years ago