1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tresset_1 [31]
3 years ago
5

Do open oceans have unlimited nitrogen, rich in silica and iron, or are nutrient-poor environments

Biology
1 answer:
Gre4nikov [31]3 years ago
5 0

Open oceans are nutrient poor environments rather than having plentiful resources.

You might be interested in
Which statement is true regarding cancer?
Rashid [163]

Answer:

The correct answers are option a. The greater the undifferentiated cell count, the more aggressive the cancer and b. Malignant tumors have the potential to kill the host.

Explanation:

Anaplasia is a medical term used to describe a condition of cells with poor cellular differentiation. It is known that the great the anaplasia, the more aggresive is the cancer. The tumors that have this characteristic are known as anaplastic carcinoma. This malignant tumors have the potential to kill the host  when they metastasize to other organs.

6 0
3 years ago
A young child runs a fever of 40 °c for 24 hours. explain what effect this may have on his digestion
Lunna [17]

Since the temperature is above 37 degrees, the child’s digestive system will begin to slow down as the enzyme begins to denature because both the internal temperature and the external body heat influence digestive processes. The effect upon the system of the temperature of food and drink is also a matter of significant consideration.

4 0
3 years ago
The The loudness of a sound is determined by the __________, or height, of the sound wave. A. frequency B. purity C. amplitude D
Rudik [331]

C Amplitude determines the loudness of the sound wave.

5 0
3 years ago
Read 2 more answers
1. Perubahan dapat terjadi karena adanya interaksi manusia dengan lingkungan.
Lady bird [3.3K]

Answer:

Dampak negatif manusia terhadap lingkungan adalah:

Kelebihan penduduk, polusi, pembakaran bahan bakar fosil, dan penggundulan hutan. Perubahan seperti ini telah memicu perubahan iklim, erosi tanah, kualitas udara yang buruk, dan air yang tidak dapat diminum.

Dampak positif manusia terhadap lingkungan adalah:

Melindungi spesies yang terancam punah dan membersihkan danau dan laut memiliki efek positif terhadap lingkungan. Di rumah, Anda dapat membantu planet ini dengan mendaur ulang limbah dan menanam tanaman atau sayuran.

6 0
3 years ago
Methane is a gas that helps trap the sun's energy within the Earth's atmosphere and is known as a (2 points)
Nikitich [7]
I'm assuming the answer would be greenhouse gas. 

Greenhouse gases are those that trap infrared radiation (from the sun) and contribute to the greenhouse effect. 
5 0
3 years ago
Other questions:
  • A simplified representation of an object, structure, or system used in analysis, explanation, interpretation, or design is calle
    12·2 answers
  • Outline and describe the steps in the process represented in this diagram
    12·1 answer
  • A man has blood group A and his wife has blood group B. Their first child has
    14·1 answer
  • An over-the-counter (otc) cold remedy taken for a cold would be classified as a(n) __________. licit drug for instrumental use i
    5·1 answer
  • What is the main difference between a cell nucleus and a nucleoid?
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Where do scientists obtain adult stem cells?<br> saliva<br> pancreas<br> skin<br> bone marrow
    6·1 answer
  • What are the answers can someone help me
    6·1 answer
  • The____groups related species
    11·1 answer
  • yellow flowered plant is crossed with red one; some of the offspring had orange color phenotype . explain what happened?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!