1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
9

Which form of cell transport allows small molecules to move from an area of higher concentration to an area of lower concentrati

on without energy being required from the cell?
A. osmosis
B. pinocytosis
C. phagocytosis
D. simple diffusion
Biology
2 answers:
attashe74 [19]3 years ago
5 0

Answer:

The most appropriate answer would be D. simple diffusion.

Simple diffusion is term used when molecules move from the region of region higher concentration to the region of lower concentration across the semi permeable membrane.

It is passive mode of transport takes place across the cell. Hence, it does not require energy.

Example may include the diffusion of gases (oxygen and carbon dioxide) across the cells.

vampirchik [111]3 years ago
3 0
I think the correct answer from the choices listed above is option D. Simple diffusion is the cell transport that allows small molecules to move from an area of higher concentration to an area of lower concentration without energy being <span>required from the cell.</span>
You might be interested in
What organ in your body produces bile?
Paha777 [63]
The Gallbladder stores bile that is produced in the liver
7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Planes are living organisms what are some of the characteristics of life that plants must fulfill
posledela
Use energy, Maintain homeostasis, and Composed of cells.
6 0
3 years ago
What was chargaffs observation about the nitrogen bases in dna
zubka84 [21]
DNA contains equal amounts of adenine/thymine and guanine/cytosine.
5 0
3 years ago
What are forest fires, temperature fluctuations, and floods all examples of?
Anna71 [15]

Answer:

Hey mate.....

Explanation:

This is ur answer.....

<h3>Abiotic, Density Independent Factors</h3><h3></h3><h3>                             OR</h3><h3></h3><h3>Most probably Global Warming....</h3><h3></h3>

Hope it helps!

Brainliest pls!

Follow me! :)

8 0
3 years ago
Other questions:
  • Which describes the four cells that are produced at the end of meiosis
    10·2 answers
  • Deep cracks in the Earth's crust are called <br> 1. craters 2. depressions 3. faults 4. drifts
    5·2 answers
  • Can animals live in space?
    9·2 answers
  • Which is the best explanation for how air masses move across the United States
    10·1 answer
  • Can you count how old the tree was?
    8·2 answers
  • The process of respiration is essential in the oxygen/carbon dioxide cycle. Respiration removes ______ from the atmosphere and p
    9·2 answers
  • Water's ___________ makes it an excellent solvent for salts, like sodium chloride, as well as other substances required by cells
    15·2 answers
  • How Do Mountain Ranges Effect Climate
    9·1 answer
  • Describe two potential biological risks of large scale cultivation and use of such genetically modified plants
    11·1 answer
  • What is active transport?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!