1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
3 years ago
9

A 15 year old male suffered diffuse brain injury after wrecking an atv. he had momentary confusion and retrograde amnesia after

5-10 minutes. his injury could be categorized as
Biology
1 answer:
Rudiy273 years ago
3 0
Grade II Concussion

The brain is made of soft tissue. It's cushioned by spinal fluid and encased in the protective shell of the skull. When you sustain a concussion, the impact can jolt your brain. Sometimes, it literally causes it to move around in your head. Traumatic brain injuries can cause bruising, damage to the blood vessels, and injury to the nerves.


You might be interested in
BIOLOGY HELP PICTURE BELOW
pantera1 [17]
I think D is the right answer.
5 0
2 years ago
QUESTION 1
wel

The individual bacteria would appear larger under the magnification of 40X. Thus, the correct option is A.

<h3>What is Magnification?</h3>

Magnification may be defined as the power of a microscope to deliver an image of an entity at a scale larger and sometimes smaller than its genuine size.

Bacillus subtilis is a distinct germ, that is rod-shaped in structure and is Gram-positive. Under the 40X microscope, it looks as rough, opaque, fuzzy white, or narrowly yellow with irregular edges.

The size of the entity or any object under the microscope of 40X magnification is 5mm, while the of the entity or any object under the microscope of 10X magnification is 1-2mm.

Therefore, it is well described above.

To learn more about Microscope, refer to the link:

brainly.com/question/15744335

#SPJ1

5 0
1 year ago
The characteristic that results from a monohybrid cross is the _____ trait.
Gala2k [10]
The answer is dominant.

A monohybrid cross involves organisms that are heterozygous for only one character. In autosomal dominant traits, the phenotype is present if both copies of the dominant allele (A) are present (homozygous individuals AA) or only one copy of the dominant allele is present (heterozygous individuals Aa). <u>Thus, t</u><span><u>he characteristic that results from a monohybrid cross is the dominant trait.</u></span>
4 0
3 years ago
A group of scientists have completed several investigations to gather evidence from fossils about the brachiopod. Which of these
riadik2000 [5.3K]
The fossils based on the brachipod
5 0
3 years ago
explain why the top of an energy pyramid does not have an arrow showing energy going back down to the bottom.
SCORPION-xisa [38]
<span>The answer to your question is that all of the energy is ultimately radiated into empty outer space as heat. The second law of thermodynamics mandates that all processes that involve the transfer of energy MUST radiate a portion of this energy into space as waste heat. This is why when you run down the street you get hot and sweaty, and this is why automobiles MUST have a functioning radiator and nuclear power stations MUST have evaporation cooling towers or else be located near a large body of water to exchange excess waste heat into, etc., etc. It is also true that the transfer of energy at each step up the food chain is very inefficient. They say it takes around 50 lbs of corn to produce one pound of beef, and it probably takes 20-30 pounds of beef to produce one pound of human tissue. The rest of the energy just goes into your living room as radiated body heat. I hope this helps.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe one model of the structure of a nucleus.
    14·1 answer
  • Predict the next digestive system organ in the following sequence:
    11·1 answer
  • Microwaves are produced when
    7·1 answer
  • A friend declares that chromosomes are held at the metaphase plate by microtubules that push on each chromosome from opposite si
    10·1 answer
  • Deduce how two genes for different traits that are on the same chromosome can fail to be inherited together.
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which type of reproduction is MOST advantageous for the production of a wide variety of organisms in an individual species? A) b
    11·2 answers
  • What is release of wastes or sell products from inside to outside a cell
    10·1 answer
  • During cell division, where are
    15·1 answer
  • The spectrum of a distant star contains sodium lines that are offset from their normal position, as shown. What is the most like
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!