1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
strojnjashka [21]
4 years ago
5

Which of these is a protein?

Biology
2 answers:
Alexxandr [17]4 years ago
4 0
There any many kinds of protein. There is meats (if you a vegetarian then you would have salads) 

Hope this helps!
skad [1K]4 years ago
4 0
Primary structure is the answer.

You might be interested in
Please help me with this question
kipiarov [429]

Answer:

B thx hope works

Explanation:

5 0
2 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The maximum resources an environment can support is known as its carrying. The graph shown here provides information on the popu
alukav5142 [94]
The answer is 100 days. At day 100 the population of the organism began to stop growing, which means it has reached its carrying capacity.
4 0
3 years ago
With respect to energy, how are ATP and glucose similar? How are they different?
denpristay [2]
They are comparable in light of the fact that they are both compound sources of vitality utilized by cells. 
They are altogether different as far as arrangement and structure.
6 0
4 years ago
Describe the manner in which you would determine how long ago two species of bacteria diverged from one another.
Andrei [34K]

Answer:

One of the probable ways to determine how long ago any two species of bacteria diverged from each other is by drawing a phylogenetic tree.

Explanation:

  • Phylogenetic tree are trees that show the ancestry of two species of interest and the relationship between them.
  • The idea behind the construction of phylogenetic tree is darwins's "descent with modification theory".
  • A phylogenetic tree is constructed using the similarities or differences in either physical characteristics, behavorial, or genetic buildup.
  • Derived traits shared between the different species are the actual data used to construct a phylogenetic tree.
3 0
4 years ago
Other questions:
  • Identify which molecule or element is described below
    6·2 answers
  • How much rain does a dessert get each year?
    11·1 answer
  • During the early stages of embryo development, dolphins have gill pouches. What does this mean?
    6·1 answer
  • Not the same as 12.5 millimeters?<br><br> 0.0000125 km<br> 0.00125 hm<br> 0.0125 m<br> 1.25 cm
    11·2 answers
  • What is back and faward movement ( Ear and sound )
    12·1 answer
  • DEFINE HEREDITY AS THE PASSAGE OF GENETIC INSTRUCTIONS FROM ONE GENERATION TO THE NEXT GENERATION.
    9·2 answers
  • Someone pls help me ill give out brainliest pls don’t answer if you don’t know
    9·1 answer
  • How is igneous rock made?I will give brainlest for a good expination not strat copy and pasted.
    13·2 answers
  • Which of the following represents a pattern in the
    15·1 answer
  • Describe this process of binary fisson? please and thank you so much
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!