1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
14

1. What is the significance of the reason rule and sequencing?​

Biology
1 answer:
alexandr1967 [171]3 years ago
8 0

Explanation:

A biological sequence may be defined as a single but a continuous molecule of a protein or a nucleic acid.  It can be a genetic map or an actual sequence of the amino acids or the nucleic acids. It can also be some more complicated data structure building of a composite view from other entries.

Sequencing is mostly used in molecular biology for studying the  genomes and proteins that they  encode.

The reason rule is the law of antitrust that says that a trade practice which violates the Act of Sherman only if that practice is the unreasonable restraint of some trade which is based on some factors.

You might be interested in
A representation of earths rounded surface on a flat surface is called?
Montano1993 [528]
A representation of earths rounded surface on a flat surface is called___a map.
8 0
3 years ago
Which of the following statements describe a plants role in a water cycle?
4vir4ik [10]
Plants absorb the water from the soil ( through their roots) and then release it back into the atmosphere by transpiration (evaporation from the leaves)
7 0
3 years ago
Help please!!!
nikdorinn [45]

it's b. anaphase and spindle fibres pulls chromosomes towards the centrioles in this phase.

7 0
3 years ago
Read 2 more answers
Single strands of nucleic acids are directional, meaning that there are two different ends. What functional groups define the tw
pickupchik [31]

Answer:

The functional groups that define the two different ends of a single strand of nucleic acids are:

B. a free hydroxyl group on the 5' carbon a free hydroxyl group on the 3' carbon

G. a free phosphate group on the 5' carbon

Explanation:

A nucleic acid is a polymer formed of nucleotides that are linked with a phosphodiester bond. The structure of a nucleotide consists on a phosphate group linked to a pentose (ribose in RNA and deoxyribose in DNA) that is also attached to a nitrogenous base. The nitrogenous bases are adenine, guanine, cytosine, thymine (in DNA) and uracil (in RNA).

DNA and RNA are nucleic acids which can be found in a double or single strand presentation.

Nucleic acids are synthesize in the 5’ to 3’ direction, so that is why the convention is that the sequences are written and read in that direction.

The strand of a nucleic acid is directional with an end-to-end orientation, where the 5’ end has a free hydroxyl or phosphate group on the 5' carbon of the terminal pentose, and the 3’ end has a free hydroxyl group on the 3’ carbon on the terminal pentose (ribose/ deoxyribose).

3 0
3 years ago
What is the circulatory Systems function 
IrinaK [193]

Answer:

circulate blood around the body via the heart, arteries an veins, etc

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • What was the main function of the protocells fatty acid membrane
    5·1 answer
  • Aristotle is known for which contribution to taxonomy?
    9·2 answers
  • Variation in snail color is an example of
    5·1 answer
  • Name the process by which soil is formed from rocks? ?
    12·2 answers
  • What determines how many covalent bonds two atoms can make?
    12·1 answer
  • The total magnification of a specimen viewed under a compound light microscope is determined by (2 points)
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Please help me with this 9th biology work
    10·2 answers
  • How many carbons , hydrogens and oxygens are on the reactant side of sugar
    7·1 answer
  • Read the quotation below from a high school science student.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!