1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
2 years ago
14

Society expects scientists to follow ethical practices and meet many ethical standards. Which is an example of one of these ethi

cal standards?
A. Investigate only the events that affect people's lives or livelihoods.
B. Analyze data that was truly observed, and not data that was expected or desired.
C. Publish experimental results only if they agree with current theories or public opinion.
D. Continue the procedure of an experiment or investigation under all circumstances.
Biology
2 answers:
user100 [1]2 years ago
5 0

Answer:

B. Analyze data that was truly observed, and not data that was expected or desired.

Explanation:

In the scientific method, scientists or researchers are expected to make fair assessments and analysis of data. This prevents, what we call bias. When making conclusions, scientists need to analyze the data as they are and what was observed even if it does not agree or come out the way they expected it. If one will manipulate the results just to justify their own reasoning, the results cannot be regarded as facts.

telo118 [61]2 years ago
4 0

Answer:

I'd say B

Explanation:

It sounds like an ethical debate to me-

You might be interested in
Which tends to increase genetic variation in a population
klio [65]

Answer:

d. mutation

Explanation:

4 0
3 years ago
Which of the following best represents a simple food chain?
Lerok [7]

Answer:

A. Producer Primary comsumer Secondary consumer

3 0
2 years ago
The basic units of the brain and spinal cord that process, store, and transmit information are the _____.
kati45 [8]

Answer:

Neuron

Explanation:

This is the applicable unit calculation for actions in which are taken within the brain and spine. Neurons allow the transfer of information, allowing us to move our body in a desired form

6 0
3 years ago
Read 2 more answers
What does this article reveal about the role Black inventors have played in America's history? Explain your answer.
cupoosta [38]

Answer:

The article revealed the fact that Black inventors have always played an active role in inventing new things in America. In the 18th and 19th centuries they were denied the right to patent their inventions because of their status as slaves. This has changed for the better in present times as many Black inventors are being granted patent rights.

Explanation:

The article, "America’s always had black inventors – even when the patent system explicitly excluded them", by Shontavia Johnson, explained the active role that Black Americans, both free and slaves played in inventing things in the United Slaves. The article explained that although the patent rights signed into the constitution in 1787 was written in a neutral tone, it did not change the fact that black inventors were actually denied patent rights.

This segregation affected people like Henry Boyd, Ned, Benjamin Montgomery among others. In recent times, this segregation has significantly been curbed as many Black inventors are now owners of patents. An example is Lonnie Johnson, inventor of the Water Gun and owner of more than 80 patents.

4 0
2 years ago
consider the diagram . which disorder is created as a result of the final chromosomal change that is shown
aksik [14]
We would need to see the diagram in order to answer the question correctly. without the diagram we can't help
7 0
3 years ago
Other questions:
  • What type of virus is HIV?
    12·2 answers
  • Which factors contribute to changing igneous and sedimentary rock into metamorphic rock
    7·2 answers
  • While cleaning a saltwater aquarium, students placed a family of fiddler crabs from the saltwater aquarium into a container of d
    5·2 answers
  • People can breed cats for specific traits such as coat color through the process of
    13·1 answer
  • Your classmate states that only precious minerals,such as diamonds,are valuable. Based on your lesson on the rock cycle, you
    10·1 answer
  • Protein sources that provide all the amino acids that cannot be manufactured in the body are considered ________
    13·1 answer
  • Which evidence did Charles Darwin rely upon the most
    5·1 answer
  • Describe two pieces of evidence that show that plants cannot make their own food without light​
    12·1 answer
  • Which of the following materials would allow the flow of electricity?
    8·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!