An action potential will not occur unless the membrane potential AT THE VOLTAGE GATED SODIUM CHANNEL reaches a level called THRESHOLD.
An action potential refers to the change in the electrical potential which occurs as a result of the passage of impulses along the membrane of muscle cells or nerve cells. An action potential occurs when there is depolarization of the cell membrane to the threshold stage.
Tough cuticle made of proteins and chitin.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
a persons risk will increase
Explanation:
D.a system would be the answer.
