1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina18 [472]
3 years ago
5

Which of the following statements about eukaryotic mRNA processing is not correct?

Biology
1 answer:
ch4aika [34]3 years ago
6 0

Answer:

The correct answer will be option-D.

Explanation:

In eukaryotes, the process of transcription takes place inside the nucleus whereas translation takes place in the cytosol. So, mRNA has to export to the cytosol from the nucleus.

Before export, the post-transcriptional modification takes place like 5' capping, 3' tailing and splicing mechanism.

The capping is done at 5' end by adding modified guanine (G) nucleotide which protects the mRNA from exonuclease activity and tailing is done at 3' end by adding adenine nucleotides which provides stability to the mRNA.Splicing removes the junk DNA called introns and joins the exons before export.

Thus, option-D is the correct answer.

You might be interested in
Somebody explain this in short?
Olenka [21]

significant digits are certain digits that give detail in a number

ex. in the number 400 it is the 4 because it tells you how many hundreds are in the number, in the number 49.92 it would be all of them because they all help understand the number

Do you get it?


5 0
3 years ago
Production of the male gametes is known as
Arte-miy333 [17]

Answer:

answer is C spermatogenesis

5 0
3 years ago
Read 2 more answers
What happens once a person is infected with a heprevirus?
hram777 [196]
<span>Herpesviridae is a large family of DNA viruses that cause diseases in animals, including humans.

When a person infected once, his immune system develops antidot against the virus, so he becomes immune for that virus for rest of his life. In other words, he can't be affected from that virus again

Hope this helps!</span>
7 0
3 years ago
Which is mixed with proteins to break them in amino acids?
nexus9112 [7]
I believe <span>Protease enzymes are what are used to break proteins into amino acids.</span>
5 0
3 years ago
Which equation represents Newton's second law of motion in terms of momentum?
kogti [31]
F • t = m • v

Momentum = mv
3 0
2 years ago
Other questions:
  • What are the four general groups that matter can be classified into?
    7·1 answer
  • Ultrasound utilizes high-frequency sound waves. When applied in targeted pulses, it can be used to break up calculi such as kidn
    13·2 answers
  • What is the first step you would take to solve this equation and why 49n+986=-43​
    9·1 answer
  • what do you call the phenomenon When you have a different concentration of materials on the inside and outside of the cell
    14·2 answers
  • A population pyramid is an illustration that shows the
    12·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • If you placed two stainless steel spheres in contact with each other and the electrical charges were distributed because a negat
    12·1 answer
  • ______ are organisms that consume other organisms.
    15·2 answers
  • Describe the outer core: Include the thickness (depth), what it is made of, whether it is solid or liquid, and one fact about it
    11·1 answer
  • a lion and a leopard have almost the same characteristics in terms of feeding habitat and behavior . explain why a leopard and c
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!