1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kenny6666 [7]
3 years ago
7

Fifty percent of the offspring produced by a cross between pea plants have seeds with a wrinkled (r) appearance caused by the pr

esence of a homozygous recessive gene. What were the genotypes of the parents? A. Rr × Rr B. Rr × rr C. RR × Rr D. RR × rr
Biology
1 answer:
tangare [24]3 years ago
8 0

Answer:

The correct option is B. Rr × rr

Explanation:

To illustrate the results, lets make a cross between RR and rr.

      r         r

R    Rr       Rr

r      rr        rr

   

The results from the following punnet square show that there will be a 50% probability that the offsprings will have heterozygous genotype Rr and they will be round.

The results from the punnet square show that there will be a 50% probability that the offsprings will be recessive and hence will have wrinkled seeds.

You might be interested in
I need help please in ASAP
WITCHER [35]

Answer:

it is either c or d

Explanation:

have a nice day!

4 0
3 years ago
N a garden with trees and shrubs, green and pink katydids were observed. Over time, birds started feeding on the katydids. Which
OlgaM077 [116]

Answer: A.The population of pink katydids will decrease.

B.The population of green katydids will decrease.

Explanation:

The two statements describe what will eventually happen to the population of the katydids are that:

• A.The population of pink katydids will decrease.

• The population of green katydids will decrease.

This is because from the information given, since birds started feeding on the katydids, this will result in the reduction in the number of katydids. Hence, the decrease in both the pink and the green katydids.

5 0
3 years ago
Help please!!!
nikdorinn [45]

it's b. anaphase and spindle fibres pulls chromosomes towards the centrioles in this phase.

7 0
3 years ago
Read 2 more answers
For 10 points, what’s the formula of riding a bike? lmk‼️‼️
Greeley [361]

Answer:

Inertia forces + gyroscopic forces + the effects of gravity and centrifugal forces = the leaning of the body

4 0
2 years ago
What causes global warming
Rus_ich [418]

Answer:

A.) Forest fires

Warming of the earth is caused by hot things overheating and holding it in with the atmosphere

8 0
3 years ago
Other questions:
  • What describes the diet of a saprotroph?. . A]Dead plant matter. B]Bones and feathers. C]Animals and fungus. D]Plants and fungus
    5·2 answers
  • Protists are helpful to us because they?
    14·1 answer
  • Is the science of naming and classifying organisms based on structural comparisons and genetic evidence.
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Only question 22 pls help i will mark brainliest
    10·1 answer
  • Which of these anatomical terms refers to the ankle?
    14·2 answers
  • What is a plate?
    6·1 answer
  • How did Scientist find the human gene that makes insulin
    10·1 answer
  • Which of the following is a correct statement?
    6·1 answer
  • The critical factor that determines gender during development is ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!