1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vampirchik [111]
3 years ago
8

What molecules does a plant need to make glucose in the process of photosynthesis?

Biology
2 answers:
asambeis [7]3 years ago
8 0

Answer: The answer is D

Explanation:

The answer is carbon dioxide and water.

Mila [183]3 years ago
3 0

Answer:

Option (D)

Explanation:

The plants has the ability to undergo the process of photosynthesis. Photosynthesis is defined as the process by which the green plants prepare their own food in the presence of sunlight, carbon dioxide (CO₂) and water (H₂O). The leaves of the green plants contains chlorophyll pigments that consumes the above molecules and helps in converting it into water, oxygen and glucose. This is how plants make their own food and they are considered as the autotrophs or producers. The consumers are dependent on this producers.

Thus, the correct answer is option (D).

You might be interested in
If one concentration of a sugar solution is lower outside the cell than inside the cell which will happen by osmosis?
timurjin [86]

C) Water will move into the cell.

8 0
3 years ago
3
trasher [3.6K]

Answer:

D

Explanation:

3 0
3 years ago
Read 2 more answers
The sub discipline of exercise science that deals with the nervous system, the muscles, reaction time is
Elena L [17]
Not sure but I think motor systems?

-Wulf
8 0
3 years ago
Why is special creation not considered a scientific explanation for the diversity of life on earth?
Rufina [12.5K]
Special Creation is a term that can be interpreted a number of ways, just as evolution can. One interpretation called Young Earth Creationism, YEC, erroneously discounts much of the physics, chemistry, biology and wealth of data that science has observed. Most pronounced is the proposition that the universe is only ~<10 k years old. Because of this, it is not considered scientific. When applied to the diversity of life, YEC's believe all life is the result of special creation events made in less than one week of time, countering the long times for organism development and progression that science has observed. YECs account for the origin of all life through special creation, while science presently has no explanation naturalistically for the origin of life. YECs do not recognize evolution, science presently considers evolution through natural selection, as the source of all living entities. While evolution is fatally flawed in explaining how life has progressed, YECs compress all life development, despite the long period of time indicated scientifically.

An alternate special creation model accepts the long era of Earth formation and life's creation and progression, attributes the origin of life to God's intelligent designed cellular functionality, considers all of the fossil evidence showing stages of radiation events, stasis and extinction as God bioformed the Earth using common design for the eventual consciously intelligent humans.
8 0
3 years ago
Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the assembly of microtubules, i
Gnesinka [82]

Answer:

a. disruption of mitotic spindle formation.

Explanation:

Vinblastine is a chemotherapeutic drug which is used to restrict cancer cell proliferation. During metaphase, it binds to microtubular proteins which play a very important role in mitotic spindle formation. If spindles will not form then during anaphase, the sister chromatids will not separate and mitosis will not take place. This is how hyper-proliferative cancerous cells are controlled from dividing and cancer is treated using this drug.

8 0
3 years ago
Other questions:
  • Will anyone help me on my biology homework...? Please and thank you?
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What does it mean if a place has high biodiversity?
    8·1 answer
  • A)what are the difference between two species of minnows?​
    13·1 answer
  • What do the 4 beans represent
    11·2 answers
  • Cells that secrete mineral deposits that form bone are called_________.
    15·1 answer
  • Slow cooling of magma leads to wath size mineral crystals
    14·1 answer
  • Which of the following Venn diagrams would BEST be suited to represent the three categories of animals?
    15·1 answer
  • Anyone wants to do dirty zoo m​
    12·1 answer
  • Even though jellies can swim, why are they still classified as plankton?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!