I'm thinking true heres why lets say you have a bird and the bird eats worms.. and all the worms in the world are gone the bird will die and what ever animal ate that bird will die and what ever animal ate that bird will die and so on
my guess
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer: The correct answer is- all the sugar maple trees that are present in a state park.
Population can be described as a group of individuals belonging to a particular species, which inhabit a particular area.
In this question, last option that is all the sugar maple trees that are present in a state park correspond to a particular population.
Other options have organisms occupying different areas across the world.
The type of asexual reproduction which is being represented is definitely C. Fission, because according to the data above the entity has divided into two or more parts which is a characteristics for the fission.
The work done is 137 joules.
Lifting opposes the acceleration of gravity, which is 9.8 m/sec/sec.
20 x 0.7 x 9.8 = 137 J (kg-m2/sec2)
